ID: 955857086

View in Genome Browser
Species Human (GRCh38)
Location 3:63284371-63284393
Sequence CTAGGGCTGCAGCATTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955857086_955857087 -8 Left 955857086 3:63284371-63284393 CCAACACAATGCTGCAGCCCTAG 0: 1
1: 0
2: 0
3: 15
4: 157
Right 955857087 3:63284386-63284408 AGCCCTAGATTCTGTGCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955857086 Original CRISPR CTAGGGCTGCAGCATTGTGT TGG (reversed) Intronic