ID: 955857961

View in Genome Browser
Species Human (GRCh38)
Location 3:63294912-63294934
Sequence TACCATGCCTACTTTGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3344
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 3295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955857961 Original CRISPR TACCATGCCTACTTTGGAAA TGG Intronic
Too many off-targets to display for this crispr