ID: 955864698

View in Genome Browser
Species Human (GRCh38)
Location 3:63371005-63371027
Sequence ATGTTCCAGTTAAAGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955864698_955864703 6 Left 955864698 3:63371005-63371027 CCCTAGACCTTTAACTGGAACAT 0: 1
1: 1
2: 1
3: 16
4: 142
Right 955864703 3:63371034-63371056 GGACACATTGCGATTCATCAAGG 0: 1
1: 11
2: 25
3: 40
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955864698 Original CRISPR ATGTTCCAGTTAAAGGTCTA GGG (reversed) Intronic
906810340 1:48820276-48820298 CTGTACCAGTTATAGGTCTCTGG - Intronic
907766905 1:57422074-57422096 ATGTGCCAATTATAGGTCTTTGG - Intronic
908055632 1:60283745-60283767 TTGTTCAATTTAAAGATCTATGG + Intergenic
908674479 1:66587919-66587941 AGGTTCCAGGTAAAGGTTAAAGG - Intronic
909288346 1:73849937-73849959 ATGTTCCAGGCAATGTTCTAAGG - Intergenic
909859057 1:80581532-80581554 AAATTCCAGTTCAAGGACTAAGG + Intergenic
910500946 1:87889529-87889551 ATCTTAGAGTTAAAGGTTTATGG - Intergenic
911426989 1:97729161-97729183 TTGTTCCAGTTAAATATCTCAGG - Intronic
911456138 1:98125937-98125959 ATGTGCTAGGTACAGGTCTAAGG - Intergenic
911507854 1:98775755-98775777 ATGTTGCAGATGAAGGTCCAAGG - Intergenic
914968534 1:152284421-152284443 ATGTTCCAATTAAAAGTCGCAGG + Intergenic
915895109 1:159806030-159806052 ATGTTCCAGGCACAGGTCTTGGG + Intronic
916264949 1:162881636-162881658 ATGTTCAAAATAAAGGTTTAAGG - Intergenic
918698172 1:187571072-187571094 ATGTTCCAGGTAAAGTTTTAAGG - Intergenic
923767434 1:236905431-236905453 ATATTCCAGTTAAAGGACAGGGG - Intergenic
1063687591 10:8252996-8253018 AGGTTCCAGTTCAAGTTCAAAGG - Intergenic
1064264314 10:13812577-13812599 GTGTCCCTGTTAAAAGTCTAAGG - Intronic
1066582934 10:36900141-36900163 ATGCTCTGGTTAAAGGTCAATGG + Intergenic
1066806894 10:39265394-39265416 ATTTTACACTTAAAGTTCTAGGG - Intergenic
1067758265 10:49023421-49023443 ATGTTTCAGTGGAAGGTTTAAGG + Intronic
1070591119 10:77801869-77801891 ATGATTCAGTTAAAGGCCTTGGG + Intronic
1071482611 10:86076611-86076633 ATGTTGCAGTTCAAGTTCAAAGG + Intronic
1072031512 10:91526472-91526494 ATGTTCCCGTTAAAGATCAAAGG + Intergenic
1072184412 10:93021458-93021480 ATGTTTCAGTTAAACTTCCAAGG + Intronic
1077299412 11:1840224-1840246 ATGTCCCAGTGCAAGGTCTGGGG + Intronic
1078806749 11:14713484-14713506 ATGTTTCAGTTCAAGTTCAAAGG - Intronic
1078822872 11:14899768-14899790 ATATTTTAGTTAAAAGTCTATGG + Intergenic
1079521765 11:21336163-21336185 AGGTTCTAGTTTAATGTCTAAGG - Intronic
1083819693 11:65161771-65161793 ATGTTACAGTTCAAGTTCAAAGG - Intergenic
1086822968 11:91458232-91458254 ATGTTTCAGATCAAGGTCTTTGG - Intergenic
1088083783 11:105953375-105953397 ATCTTCCAGATAAAGGTGAATGG - Intronic
1088510679 11:110570914-110570936 TTGTTCCAATTCAAGGTCTCGGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090487540 11:127127478-127127500 ATGTTCCAGATAAGAGTCTACGG + Intergenic
1095134771 12:38586886-38586908 ATTGTGCAATTAAAGGTCTAGGG - Intergenic
1099403641 12:82231936-82231958 AAGTTCCACTTGAAGGTCTCTGG - Intronic
1107347329 13:39475796-39475818 CGGTTCCAGTAAAAAGTCTAAGG + Intronic
1110140890 13:72127812-72127834 ATGTTCCATTTAATGGTTTATGG + Intergenic
1117439451 14:55746143-55746165 ATGTTCCAGTTAGAAGTCCCAGG + Intergenic
1122337294 14:101002122-101002144 ATCTACCAGATAAAGGTCAAGGG - Intergenic
1124461036 15:29891902-29891924 ATGTTCAAGTAAAAGGTCTAAGG + Intronic
1125534245 15:40434301-40434323 AAGTTCCATTTAACTGTCTATGG - Intronic
1126970484 15:54105570-54105592 ATGTTGCATTTTAAGGTCTCAGG + Intronic
1128390432 15:67179224-67179246 ATGATCCAGTTAAATATCTAGGG + Intronic
1128935605 15:71743863-71743885 ATGTTGCAGTTAAAATTGTAAGG + Intronic
1139808683 16:69593236-69593258 ATGTTATAGTGAAATGTCTAAGG + Intronic
1140645564 16:77026186-77026208 ATGCTACAGTTAAAAGTATAAGG - Intergenic
1141400953 16:83746219-83746241 ACGTTCCATCTAGAGGTCTAGGG + Intronic
1142949549 17:3466590-3466612 ATGTGCCAGTTGAAGCTGTAAGG + Intronic
1145248186 17:21283572-21283594 ATGTACCAGGCAAAGGTCAAGGG - Intergenic
1146830318 17:36063417-36063439 ATGTTTCAGTTTAAGTTCAAAGG - Intergenic
1155373732 18:25133810-25133832 ATGTTTTAGTTAAAGGCCTGAGG + Intronic
1155646086 18:28079606-28079628 ATGTTACGGTTAATGGTTTAAGG + Intronic
1155698931 18:28718546-28718568 CTGTTTCAGTTAAAGTTTTATGG + Intergenic
1155793788 18:30007694-30007716 ATGTTCCAATTTAATGTTTAGGG - Intergenic
1156591690 18:38496939-38496961 ATGTCCCAGTTCCAGGTGTAGGG - Intergenic
1157674614 18:49560054-49560076 ATTATCCAGTTAATGTTCTAGGG + Intergenic
1159229761 18:65591111-65591133 ATGTTCCAATTATTGGTCTGTGG - Intergenic
1159823141 18:73172404-73172426 ATGTAACAGTTAAAGGTCTTTGG - Intronic
925208303 2:2026084-2026106 ATGCTCTAGTTAGGGGTCTAGGG + Intronic
927361784 2:22243740-22243762 ATGTTCCTGTTAGAGGTAGAGGG - Intergenic
928314310 2:30233841-30233863 ATGTTCCACTTAAAGCCCCAAGG - Intronic
930107958 2:47654891-47654913 ATCTTCCCGTTAGAGTTCTAGGG - Intergenic
932199746 2:69814966-69814988 ATGTTCCAGTTCAAGTCCAAAGG + Intronic
935719049 2:105963672-105963694 ATTTTCCAAGTAAAGGTCAATGG - Intergenic
937759739 2:125587003-125587025 ATGTTCCTGTTGAAGCTCAAGGG - Intergenic
938510672 2:131939313-131939335 ATGTTTCAGTTAAGGCTCTAAGG + Intergenic
940894052 2:159063410-159063432 AAGTTCCAGTTATGGGTTTAAGG + Intronic
941155074 2:161967354-161967376 TTATTCCAGTTCAAGGTCGAGGG - Intronic
944104180 2:196061598-196061620 ATGTTCTAGGTAAAGCTCAAAGG - Intronic
944188026 2:196971285-196971307 AAGTTGCAGTTAAATGTTTATGG - Intronic
944454822 2:199882497-199882519 ACCTTCTAGTTAAAGGTTTATGG - Intergenic
945029699 2:205651807-205651829 ATGTTTCAGTTCAAGTTCAATGG - Intergenic
949070405 2:242020996-242021018 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070438 2:242021174-242021196 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070522 2:242021589-242021611 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070570 2:242021834-242021856 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070619 2:242022080-242022102 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070718 2:242022519-242022541 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
1168774710 20:438209-438231 ATGTTCCAGTTCACCTTCTATGG + Exonic
1169573455 20:6931385-6931407 ATGTTCAAGTTAAAGTTGTGAGG + Intergenic
1169882449 20:10361856-10361878 TTGTTCCAGGAAAAGGTTTATGG - Intergenic
1169958826 20:11135832-11135854 ATGTGCCAGGGAAATGTCTAAGG - Intergenic
1170491182 20:16876530-16876552 ATATTCCAGTAAAAGATGTAGGG + Intergenic
1170615920 20:17950843-17950865 TTGGTCCAGTTTAAGGTGTATGG - Intronic
1174148997 20:48472905-48472927 CTGTTCTAGTTTAAGGTCCATGG - Intergenic
1174149051 20:48473269-48473291 CTGTTCTAGTTTAAGGTCCATGG - Intergenic
1174868139 20:54157991-54158013 ATTTTCCAGTACAAAGTCTAGGG + Intronic
1175935740 20:62513187-62513209 ATGTTCCAGAAGAAGGTGTAGGG + Intergenic
1176783157 21:13223986-13224008 ATGTTTCAGTTAAGGCTCTAAGG - Intergenic
1177040944 21:16109877-16109899 ATGTTTCAGTGATAGGACTAGGG - Intergenic
1177108498 21:16992650-16992672 ATGTTGCAGTTCAAGTTCGAAGG - Intergenic
1177980798 21:27912786-27912808 ATGTTTCAGTTAAGGCTCTAAGG - Intergenic
1178511111 21:33205868-33205890 ATGTGCCTGTTAGATGTCTAAGG - Intergenic
1183089771 22:35513856-35513878 GGGTTTTAGTTAAAGGTCTAGGG + Intergenic
950210856 3:11121971-11121993 ATGCTTCAGTTAAGGGTCTTAGG + Intergenic
953605879 3:44412905-44412927 ATGATCCAGTTAAGGCTCTTGGG - Intergenic
955864698 3:63371005-63371027 ATGTTCCAGTTAAAGGTCTAGGG - Intronic
956316486 3:67943407-67943429 ATGTTGCAATTAATGCTCTAGGG + Intergenic
957384437 3:79477822-79477844 ATTTACCAGTTTAAGGTCCATGG + Intronic
957844839 3:85718243-85718265 ATGTTCCAGTTATAGATTTAGGG + Intronic
960138970 3:114133910-114133932 AAGTTCCAGTTCAAAGTCTCAGG - Intronic
962435314 3:135361102-135361124 ATGTTCCAGTTTGGGGTCTTAGG + Intergenic
964281822 3:155076116-155076138 ATTTCCAAGTTAAAGATCTATGG - Intronic
965686956 3:171314319-171314341 AGGTGCCAGTCAAAGGTCTCAGG - Intronic
966614710 3:181900949-181900971 ATGGCAGAGTTAAAGGTCTAGGG + Intergenic
968239096 3:197059407-197059429 ATGTTCCAATTAAAAGACAAGGG - Intronic
970160501 4:13183847-13183869 ATGTTTCAGTTAAAGTTCCAAGG - Intergenic
970916665 4:21343830-21343852 ATGTGCCAGTTATAGTTCCAAGG + Intronic
971023128 4:22558600-22558622 ATGTTCCAGTTCAAGTGCAAAGG - Intergenic
971070564 4:23086700-23086722 CTGTTCCAGTTATTGTTCTAAGG - Intergenic
971998876 4:34003031-34003053 ATATTCCAGTTAAGTGTGTATGG - Intergenic
976442718 4:85094234-85094256 AAGTTCCAGGTAAAGGTAAAAGG - Intergenic
977636105 4:99300208-99300230 ATGATTCAGTTAAAGGTCTTGGG + Intergenic
977732257 4:100367929-100367951 ATGCTCCAGGGAAAGGTCTTAGG + Intergenic
979108141 4:116714136-116714158 CTGTGCCAGTTCCAGGTCTAAGG - Intergenic
982915325 4:161202065-161202087 ATGCTCCAGTTGAAGGTCATGGG + Intergenic
984053345 4:174894894-174894916 AAGATCCAGTTAAAAGTTTAGGG + Intronic
984912183 4:184684548-184684570 ACCTTCCAGCTAAAGGTCTCAGG + Intronic
984916926 4:184733570-184733592 ATGCTCCAGTTTACGGTCTGTGG + Intronic
986646765 5:9924340-9924362 ATGTTTCAGTTCAAGATCAAAGG - Intergenic
989411897 5:41129075-41129097 ATGTTACAGTGAAAAGTCCATGG + Intergenic
990099566 5:52164734-52164756 ATGTTCCAGTTCAAGTTCAAAGG - Intergenic
990511565 5:56493746-56493768 ATGTTACAGTTGATGGTCCATGG + Intergenic
991485375 5:67129994-67130016 TTATTTCAGTTAAAGGTCAAGGG - Intronic
992112307 5:73507197-73507219 ATGTTCCAGTTAGATGTTTCTGG - Intergenic
993409690 5:87558532-87558554 ATTTTCCACTTAAAGGAATAAGG - Intergenic
996472820 5:123879666-123879688 ATGTTACATTGAAAGGTCTTGGG + Intergenic
996607708 5:125343595-125343617 ATATTCCAGTTTCAGCTCTACGG - Intergenic
1000624598 5:163524848-163524870 ATGTTCCAGTTAGAGTTGAAAGG + Intergenic
1001971894 5:175962838-175962860 ATGTTCTGATTAAAGGTCTGGGG + Intronic
1002245548 5:177880941-177880963 ATGTTCTGATTAAAGGTCTGGGG - Intergenic
1011805357 6:91066403-91066425 ATGTTAAAGTTAAATGTCTCAGG + Intergenic
1012154120 6:95794978-95795000 ATGTTGCAGTTCAAGGTTGATGG + Intergenic
1012248321 6:96952186-96952208 TTATTCCAGTTCAAGGTCTTGGG - Intronic
1012855806 6:104499956-104499978 ATTTTCCAGTTAAATGTGCAAGG + Intergenic
1014681063 6:124430995-124431017 AAGTTCCATTTACATGTCTATGG - Intronic
1016774955 6:147895339-147895361 ATATTCCAGTTAAAGGTCTATGG - Intergenic
1018185393 6:161262020-161262042 ATGTACCAGGCAAAGGTCTACGG - Intronic
1021951492 7:25779285-25779307 ATGTTCCAGTTCAAGTCCAAAGG + Intergenic
1022835435 7:34109214-34109236 ATGTTTCAGTTCAAGTTCAAAGG + Intronic
1026142662 7:67719495-67719517 ATGTTTCAGTTTAAGTTCAAAGG - Intergenic
1045342948 8:101270562-101270584 AAGTTCCAGTTCAAGGACAAAGG - Intergenic
1046478279 8:114778787-114778809 ATTTTCCAGTTGAAGGTTTGTGG + Intergenic
1047725820 8:127683149-127683171 ATGTTCCAGTGAAAGTGCCAGGG - Intergenic
1048671285 8:136724394-136724416 ATGTTCCAGTGAGAGGTATTTGG - Intergenic
1050238187 9:3605351-3605373 ATGTTCCAGTTCTTGATCTAGGG - Intergenic
1050911609 9:11078646-11078668 ATGTTCTAATTAAAAGTTTATGG + Intergenic
1052240578 9:26267871-26267893 ATGTACCAGTTAAATGTGTCTGG - Intergenic
1055116450 9:72610486-72610508 ATGTTTCAGTTAAAGTCCAAGGG + Intronic
1056769855 9:89469122-89469144 ATGTTCCTTTTTAATGTCTATGG - Intronic
1060515300 9:124262003-124262025 ATGTTCCATGTAAAGTTCCACGG - Intronic
1060569552 9:124625882-124625904 ATGTTCCAGTTCAAGTCCAAAGG - Intronic
1188476913 X:30601430-30601452 ATGTGCCAGTTGAAGCTGTAAGG + Intergenic
1188671641 X:32888544-32888566 ATGTTCCCATTAAGGGTCCAAGG - Intronic
1190455399 X:50622785-50622807 AGGTCCCAATTAAAGGTCTCAGG - Intronic
1192668456 X:73112788-73112810 ATGTTCCAGTTCAAGTTCAAAGG - Intergenic
1193980353 X:88174928-88174950 ATGTTCCAATTAAAAGTCTGAGG - Intergenic
1196114164 X:111981246-111981268 ATGTTTCAGTTCAAGTTCAAAGG + Intronic
1196709187 X:118744768-118744790 TTGTTCCAGTTAGAGGGTTACGG - Intronic
1198776067 X:140180069-140180091 GTATTACAATTAAAGGTCTAGGG - Intergenic