ID: 955865387

View in Genome Browser
Species Human (GRCh38)
Location 3:63377035-63377057
Sequence CAGTTGTACTTGGGAAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955865387_955865391 0 Left 955865387 3:63377035-63377057 CCCGTTTTTCCCAAGTACAACTG 0: 1
1: 0
2: 0
3: 14
4: 177
Right 955865391 3:63377058-63377080 ATGTAGCTATGTATAAGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955865387 Original CRISPR CAGTTGTACTTGGGAAAAAC GGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900733357 1:4277934-4277956 CAGTTGGACTTGTGAAGAAAAGG - Intergenic
905785742 1:40755932-40755954 CAGCTGTAGTTGGGGATAACTGG + Intronic
906952603 1:50346987-50347009 CAGTTCTGCTTGGGAAGATCAGG + Intergenic
907217744 1:52880227-52880249 TAGCTGGTCTTGGGAAAAACAGG + Intronic
910520306 1:88113713-88113735 TAGTTGTCATTGGGAAAAATTGG + Intergenic
911619446 1:100050356-100050378 CAGCTGTACTTTCCAAAAACAGG + Intronic
913077671 1:115354639-115354661 CAGCTGTTCTTGGGAAATGCTGG - Intergenic
915802106 1:158805104-158805126 CAGTTGTACTGGGCAAACAAGGG - Intergenic
917596486 1:176534272-176534294 CATTAGAACCTGGGAAAAACAGG - Intronic
923516498 1:234702194-234702216 CAGCTGTGCTTGTGATAAACAGG + Intergenic
1062891940 10:1068840-1068862 CAGTTGTATTTGGCAATAAAAGG + Intronic
1063139650 10:3245018-3245040 CAGTTGAACATGGGAACACCTGG - Intergenic
1063420703 10:5910776-5910798 AAGTTGTATTTGGGAAACAGGGG - Intronic
1064325709 10:14349347-14349369 CATTTAAACTTTGGAAAAACAGG + Intronic
1064956787 10:20920154-20920176 CTGTTGGACTGTGGAAAAACAGG + Intronic
1067883388 10:50066956-50066978 AAGCTGTACTTGGGATAATCAGG + Intergenic
1075586968 10:123665483-123665505 CAGCTGTTCTTGGGACAGACAGG + Intergenic
1075867886 10:125742783-125742805 CAAGTGTACCTGGGAAAACCTGG + Intronic
1076138759 10:128063413-128063435 CACTCTTACTTGGGAAAAAAAGG - Intronic
1076271001 10:129152122-129152144 CAGGTTTTCTTGGGAACAACTGG + Intergenic
1076578943 10:131494054-131494076 CAGTTGTACCTGGGAAAATGGGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078666202 11:13327443-13327465 CAGGTGAACTTGGGAGCAACAGG - Intronic
1079035753 11:17018370-17018392 TACTTGTAATAGGGAAAAACTGG + Intergenic
1080066031 11:28014667-28014689 CAATTGTTATTGGGAAGAACAGG + Intergenic
1080412161 11:32035868-32035890 CAGATGTATTTGGGAATCACTGG + Intronic
1080846025 11:36027723-36027745 CAGTTGTTCTTGGGCACAAGGGG + Intronic
1081670816 11:44941543-44941565 CAGGTGTAGTTGGGAAAATAAGG + Intronic
1082944166 11:58740522-58740544 CAGGTGCACATGGGAAGAACTGG + Intergenic
1086266662 11:85007133-85007155 AATTTGTACTTAGGAAAATCTGG - Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1089979707 11:122762192-122762214 CTGTTGTCCTTGGGTAAGACAGG + Intronic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1105459887 13:20574366-20574388 CATTTGTACCTAGGAAAAACTGG - Exonic
1106825702 13:33518239-33518261 CAGATTTACTTGGGCAAGACAGG + Intergenic
1109737634 13:66507632-66507654 CAGTGGTAACTGGCAAAAACGGG + Intronic
1111085970 13:83375110-83375132 AAGTAGTACTTGGGAATCACAGG + Intergenic
1111633842 13:90877814-90877836 CAGTTATTCTTGGGAACAAGAGG - Intergenic
1112131297 13:96526541-96526563 CAATGGTACTAGGGAAAAAAAGG - Intronic
1112539852 13:100298387-100298409 CACTTCTATTTGGGAAACACCGG - Intronic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1115626970 14:35203229-35203251 CAGCTGAACTAGTGAAAAACAGG - Intronic
1116336253 14:43660535-43660557 CATTTTTAATTTGGAAAAACTGG + Intergenic
1120511541 14:85421661-85421683 CTGTAGTACTGGGGAAAAAAGGG + Intergenic
1120595422 14:86428384-86428406 AAAATGTACTTGGCAAAAACAGG + Intergenic
1123222591 14:106870981-106871003 TCTTTGTACTTGGGGAAAACTGG + Intergenic
1123695755 15:22878028-22878050 GAGTTGTGTTTGGGAAGAACAGG - Intronic
1123873899 15:24604737-24604759 CAGTTGTATTTTGAAAAAAGAGG + Intergenic
1125434330 15:39629066-39629088 CAGTTGAACTTGGAAAGTACAGG - Intronic
1125871046 15:43102054-43102076 CACTTGAACTTGGGACAAAGAGG + Intronic
1126323606 15:47450821-47450843 CATTGTTACTGGGGAAAAACAGG + Intronic
1127113697 15:55702260-55702282 TAGTTCTACTTGGGAAAATCAGG - Intronic
1132015527 15:98313093-98313115 CAGTTGCACATGGGAAAGGCAGG + Intergenic
1134782921 16:16915009-16915031 CATTTGTAAATGTGAAAAACTGG + Intergenic
1135477714 16:22792153-22792175 TATTTGTAGTAGGGAAAAACTGG + Intergenic
1137226658 16:46518667-46518689 CAGTTCTACTTGGGAAGCTCAGG + Intergenic
1137526015 16:49236995-49237017 CAGGTGTGCTTGGAAAAGACAGG + Intergenic
1139274832 16:65717821-65717843 CAGAAGCACTTGGGAAAAAAAGG + Intergenic
1140496062 16:75389859-75389881 CAATTGTGCTTGGGAAAAGACGG - Intronic
1141329160 16:83092717-83092739 TAGGTGTATTTGGGAAAACCTGG - Intronic
1142995440 17:3757302-3757324 CAGGTGTACTTTGGTAAAACTGG - Intronic
1146091604 17:29884793-29884815 CAGTTGTGGTTGGGATAGACAGG - Intronic
1146902990 17:36600369-36600391 CAGTTGTAAATGTGAAAAATGGG + Exonic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1158152467 18:54387966-54387988 CAGTTGGAGTTGGGACCAACAGG - Intergenic
1159353969 18:67312800-67312822 CAGTTCTATTTAGGGAAAACAGG + Intergenic
1164668089 19:30055459-30055481 CAATTGTACTTTTGAAAAATTGG + Intergenic
1165809414 19:38601859-38601881 CAGTTGAACTTGGGAAGCAGAGG - Intronic
1166476706 19:43132924-43132946 AAGATGTCCTGGGGAAAAACTGG + Intronic
1168556149 19:57342292-57342314 CAGTTGAACTTGGGAGACAGAGG - Intergenic
925004797 2:433539-433561 CAGTTGTATGTGATAAAAACAGG - Intergenic
925825424 2:7843797-7843819 CAGCTTTACCTGGGAAGAACTGG - Intergenic
925990717 2:9252003-9252025 CAGATGTACTTGGGAAGTACTGG + Intronic
926540808 2:14178832-14178854 CAGCTCTACATGGCAAAAACTGG - Intergenic
927007205 2:18863182-18863204 AAGTTGTACTTAGGAAAAGATGG - Intergenic
927266305 2:21155877-21155899 CATTTGTACTTTTGAAACACAGG + Intergenic
930063847 2:47312494-47312516 CAGATGTACCTGGGACGAACTGG - Intergenic
930308896 2:49713201-49713223 CAGTTGTCCTTGAATAAAACAGG + Intergenic
930887911 2:56349210-56349232 GAGTCATACTTGGGAAAAAATGG + Intronic
931623902 2:64238013-64238035 CAATTGTGTATGGGAAAAACTGG - Intergenic
932255389 2:70281225-70281247 TAGATGTACTTGGGAAAGTCAGG + Intergenic
932643074 2:73470514-73470536 CTATTGTGCTTGGGAAAAAAAGG + Intronic
934934248 2:98453042-98453064 GAGTTGTACTTGCAAAAAAGGGG - Intronic
935646508 2:105340188-105340210 GAGTTGTACTGGGGGCAAACGGG + Intronic
935702462 2:105824434-105824456 CAGAAGTACTTGGGAAAGGCAGG + Intronic
935888709 2:107651851-107651873 AACTTATACTTGGGAAAAAATGG + Intergenic
936585459 2:113753615-113753637 CAGTTGTACTTTGATGAAACTGG - Intronic
937975757 2:127581270-127581292 CATTTGGACTGGGGAACAACCGG - Intronic
938719267 2:134051519-134051541 GAGTGGTACTTTGGAAAAACCGG - Intergenic
938801484 2:134767334-134767356 CATTTGTATTTAAGAAAAACTGG + Intergenic
941728453 2:168889802-168889824 CAGTTTTACTTGTGAGAAAATGG - Intronic
943442360 2:187941749-187941771 TAGTTACACTTTGGAAAAACAGG + Intergenic
943758180 2:191580063-191580085 CAGTTATAATTGGAAAATACAGG + Intergenic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
1169488589 20:6053285-6053307 CAGTTCTAATGGGGAAAAGCGGG - Intronic
1170446619 20:16434541-16434563 AGATTGTACTTGGAAAAAACTGG + Intronic
1170643795 20:18178976-18178998 CAGTTCTACATGGGAGAAATAGG + Intronic
1171254087 20:23673202-23673224 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171260588 20:23728469-23728491 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1171269705 20:23804314-23804336 CAGTTGCACTTGGGGAAAGCTGG + Intergenic
1177166632 21:17612163-17612185 CCCTTGAACTTGGGGAAAACCGG - Intronic
949387102 3:3515101-3515123 CAGTTGTATGTGGTAAAGACTGG + Intergenic
949420332 3:3858383-3858405 CATTTGAACTTGGGAAAGTCGGG + Intronic
952701779 3:36336174-36336196 CAGTTCTAGTGGGGAAAAATGGG - Intergenic
953575256 3:44108255-44108277 CAGTAGCACCTGGGAAAAGCAGG + Intergenic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
959349395 3:105242218-105242240 CTGTTGTAATTGGTTAAAACTGG - Intergenic
959384139 3:105680658-105680680 CAGTGGTACTTGTGAGAAAATGG + Intronic
960451034 3:117808456-117808478 TAGTTGTAATAGGGAAAAGCTGG - Intergenic
961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG + Intronic
963541248 3:146592177-146592199 TGGTTGTACTTGGGATAAAATGG - Intronic
966535288 3:181026426-181026448 ATTTTTTACTTGGGAAAAACTGG + Intergenic
966564053 3:181356362-181356384 CAAGTATATTTGGGAAAAACAGG - Intergenic
966811240 3:183846860-183846882 CAGTTATAGATGAGAAAAACAGG + Intronic
967077232 3:186014446-186014468 CATTAGTAGTAGGGAAAAACTGG - Intergenic
967933801 3:194710272-194710294 CAAATGAACTTGGGAAACACTGG + Intergenic
968814515 4:2815052-2815074 CACTTGTGCTCGGGAAAACCAGG - Intronic
969611688 4:8231220-8231242 CAGTTGTACTGGCGTGAAACTGG - Intronic
971212480 4:24632609-24632631 AAGTTTTACTTGTGAAAAAATGG + Intergenic
975585261 4:75941971-75941993 CAGTTGTCTGTGGGTAAAACAGG + Intronic
977724965 4:100285638-100285660 CATTTGTAACCGGGAAAAACTGG - Intergenic
978463239 4:108980941-108980963 TAGTTGTACAAGAGAAAAACGGG - Intronic
978617828 4:110613590-110613612 CAGTGGTAGTTGTGGAAAACAGG - Intergenic
978953129 4:114585220-114585242 CAGTTGTTCTGGGGTAAAAAAGG + Intergenic
981289842 4:143061737-143061759 CATTTATAATTGGGAAAAATTGG + Intergenic
982500281 4:156145654-156145676 CAGTTTTGCTTGTGATAAACAGG + Intergenic
982694436 4:158583294-158583316 AAGTTGTACTTGGGAAATAATGG - Intronic
983672238 4:170251529-170251551 CAATTGTACGTGGGGAACACTGG + Intergenic
983980798 4:173994386-173994408 CAATTGTAATTGTGAAACACTGG + Intergenic
988335843 5:29908299-29908321 CAGTTGCAATTGGGAAGAAAAGG - Intergenic
988789873 5:34597655-34597677 CATTTGGGCTTGGCAAAAACAGG + Intergenic
988808574 5:34763259-34763281 CAGCTGTACGTGAGAAGAACTGG - Intronic
988860772 5:35275793-35275815 CAGTTGCCCTTGGGTAAAAGGGG - Intergenic
990519683 5:56566861-56566883 CAGGTGTTCTTGGGAAGAGCAGG - Intronic
992286854 5:75244649-75244671 GAGTTGTAGGTGGGAAAAAAAGG + Intergenic
993029148 5:82684189-82684211 CAGTTAAACTTCAGAAAAACAGG + Intergenic
993775177 5:91985496-91985518 CTTTAGTACTTTGGAAAAACGGG - Intergenic
994406669 5:99353181-99353203 CAGTTGGAGTTGGGAACAAATGG - Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
995793331 5:115916877-115916899 CAGTTGTAGTTGAGCAAAGCTGG - Intergenic
999099339 5:149009925-149009947 CAGTAGTAAATGGGAAACACTGG + Intronic
1000167765 5:158671791-158671813 CAGTTATATTTGGAAAAGACTGG + Intergenic
1001270807 5:170310223-170310245 CAGCTGTACCTGGCACAAACTGG + Intergenic
1002277873 5:178114879-178114901 CAAGTGTCCTTGGGAGAAACAGG + Intronic
1005137764 6:22590593-22590615 CAGTTGGACATCAGAAAAACTGG - Intergenic
1006997927 6:38280035-38280057 CAGATGTTCTTTGGAAAAGCAGG - Intronic
1010185450 6:73138701-73138723 CAGGTGTTTATGGGAAAAACTGG + Intronic
1014911072 6:127093606-127093628 CAGTTGTAGATAGTAAAAACTGG + Intergenic
1016107411 6:140179764-140179786 GAGTTGTACTTAGCAAAAAGTGG - Intergenic
1017338886 6:153296745-153296767 CAGCTTTATTTGGGAAAAATAGG - Intergenic
1019377918 7:705605-705627 TATTTGTAGTTGGCAAAAACTGG + Intronic
1020778921 7:12493954-12493976 CATTAGTACTTGAGAAAAAGAGG + Intergenic
1021044719 7:15908428-15908450 CAGTTGGAAGTGGGAAAAACTGG - Intergenic
1021279033 7:18694245-18694267 CAATTGTAGATGGGAAAAAATGG + Intronic
1021786584 7:24158398-24158420 GAGTTTTATTTGGGAAGAACTGG + Intergenic
1022344470 7:29501116-29501138 TAGTTGTGCTTTGGAAAAATGGG - Intronic
1023361851 7:39425201-39425223 CATTTGTAATTGGAAAACACAGG + Intronic
1024024099 7:45396828-45396850 CAGTTGTTCTGGGGAAAATTGGG - Intergenic
1027631076 7:80607012-80607034 CAGCTGAAGTTGGGAAACACAGG + Intronic
1027984892 7:85274927-85274949 CAGTTGTATTTTAGAAAAATGGG + Intergenic
1030245953 7:107384517-107384539 CAGTTTTACTGGGGGAAAAGGGG - Intronic
1030937698 7:115606121-115606143 CAGGTGCTCATGGGAAAAACTGG - Intergenic
1031118054 7:117689708-117689730 CTGGTGTATTTGGGAAGAACAGG + Intronic
1033938756 7:146623671-146623693 CATTTGTAATTTGCAAAAACTGG - Intronic
1034486570 7:151368573-151368595 CATTTGTACTTGTTAATAACAGG + Intronic
1035938905 8:3874292-3874314 CACCTGTACTTTGGAAATACAGG + Intronic
1037118252 8:15251941-15251963 CAGTTAGACTTGGGGAAAAATGG - Intergenic
1037817130 8:22118241-22118263 CAGCTGGACTTGGGAACCACGGG + Intronic
1038304655 8:26388467-26388489 AATTTGTACTTGGGATACACTGG - Intronic
1042371576 8:67997439-67997461 CAGTTATACTAGGGATAAAGGGG + Intronic
1043760859 8:84066049-84066071 AAATTGAACTTGGGAACAACTGG - Intergenic
1044783495 8:95769223-95769245 AAGTTGGAGGTGGGAAAAACGGG + Intergenic
1045153787 8:99442442-99442464 CAATTGTACTTGGGGAAGGCAGG - Exonic
1045525250 8:102935958-102935980 AGGTTTTACTTGGGAAAAACAGG + Intronic
1046496466 8:115020628-115020650 CAGTTGTGCTTAGGAATAAATGG + Intergenic
1048159330 8:131999274-131999296 CAGTTGCATTTGGGGAAAAAAGG - Intronic
1050452666 9:5799813-5799835 CAGTAATACTTAGGAAAAGCAGG - Intronic
1051071089 9:13168324-13168346 CAGTTTAACTTGGGAAATTCAGG - Intronic
1055400893 9:75922804-75922826 CACTTGAACCTGGGAAAATCTGG + Intronic
1186186754 X:7028521-7028543 AAGATGTTCTGGGGAAAAACTGG + Intergenic
1187806302 X:23125264-23125286 CAGTTGATCCTGGAAAAAACAGG - Intergenic
1188039022 X:25350556-25350578 CAGGTGATCTTGGGAAGAACTGG + Intergenic
1189986783 X:46560460-46560482 CAGTCGTAATTGCTAAAAACTGG - Intergenic
1191183265 X:57584190-57584212 CATTTGTGCTAGTGAAAAACTGG + Intergenic
1191214107 X:57918204-57918226 CAATTGTACTAGTGAAAAACTGG - Intergenic
1193796939 X:85888491-85888513 TAGCTGTACTCAGGAAAAACCGG - Intronic
1195118240 X:101721798-101721820 CAGTACGACTTGGGATAAACTGG - Intergenic
1195745578 X:108114000-108114022 AAGTTGTAATTGCGAAAAGCAGG + Intronic
1199251190 X:145664085-145664107 CAATTATACTTCGGTAAAACTGG - Intergenic
1199712408 X:150479007-150479029 CTGTTGAATTTGGGAAACACAGG + Intronic
1201331828 Y:12831663-12831685 CACTTGAACTTGGGAAACAGAGG + Intronic