ID: 955866813

View in Genome Browser
Species Human (GRCh38)
Location 3:63392972-63392994
Sequence CCATAGGTATGTACAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955866813_955866818 -5 Left 955866813 3:63392972-63392994 CCCATTTCTGTACATACCTATGG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 955866818 3:63392990-63393012 TATGGCCGTGGAAAACTAAATGG 0: 1
1: 0
2: 0
3: 5
4: 82
955866813_955866821 4 Left 955866813 3:63392972-63392994 CCCATTTCTGTACATACCTATGG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 955866821 3:63392999-63393021 GGAAAACTAAATGGTGTGGATGG 0: 1
1: 0
2: 2
3: 15
4: 195
955866813_955866820 0 Left 955866813 3:63392972-63392994 CCCATTTCTGTACATACCTATGG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 955866820 3:63392995-63393017 CCGTGGAAAACTAAATGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
955866813_955866822 5 Left 955866813 3:63392972-63392994 CCCATTTCTGTACATACCTATGG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 955866822 3:63393000-63393022 GAAAACTAAATGGTGTGGATGGG 0: 1
1: 0
2: 0
3: 20
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955866813 Original CRISPR CCATAGGTATGTACAGAAAT GGG (reversed) Intronic
900594446 1:3474385-3474407 CCCCAGGGATGTGCAGAAATGGG + Intronic
909293611 1:73915091-73915113 CCATATGAATGCACAGAGATTGG + Intergenic
910608450 1:89113289-89113311 CCATAGGTATTTTCAGTATTTGG + Intronic
911212304 1:95155061-95155083 CCAAAGGCCTGGACAGAAATGGG - Intronic
911957164 1:104251868-104251890 CCATATATATGTACAAAATTGGG + Intergenic
912419689 1:109534762-109534784 CCATAGGAATGTACTCAAAATGG + Intergenic
917350382 1:174071225-174071247 CCATAGATGGGTACAGAAGTGGG - Intergenic
921353554 1:214262735-214262757 CCACAGGTATGTGCAAAAAAGGG + Intergenic
923481471 1:234389288-234389310 TCATAGATATGTACATACATGGG + Intergenic
923806470 1:237263434-237263456 CCATAGAAATGGACAGAATTGGG + Intronic
924301886 1:242648029-242648051 TAGTAGGTATGGACAGAAATGGG + Intergenic
1065564526 10:26995529-26995551 TCATAGGTATGCACAGAAGTTGG + Intronic
1067970564 10:50965597-50965619 GCATAGTTATGTACAACAATAGG - Intergenic
1075974563 10:126684377-126684399 CCATTGACATGTACACAAATGGG - Intergenic
1078581520 11:12542840-12542862 CCACAAGTATGTTCAGAAACTGG - Intergenic
1079415246 11:20228848-20228870 CCATAGGTATGGACAGAGCAGGG + Intergenic
1081251116 11:40835374-40835396 AAATATGTAAGTACAGAAATGGG - Intronic
1084344655 11:68538446-68538468 CCATAGGTATGTAAAGTATTGGG + Intronic
1084918653 11:72450939-72450961 TCATAGGCCTGTACAGAAAAGGG - Intergenic
1085255952 11:75173214-75173236 CCATAGGAATGTTAAGAATTGGG + Intronic
1085725725 11:78952998-78953020 CCAGAGTTATTTATAGAAATAGG + Intronic
1086379389 11:86236489-86236511 CCATTGGTCTGTAAAGTAATAGG - Intergenic
1086729218 11:90227514-90227536 CAATAGGTATGTATAGGCATTGG + Intergenic
1088092574 11:106060260-106060282 ACATAGGTATGTATATAAAATGG - Intronic
1094280386 12:28730816-28730838 CTATATGTATATACTGAAATTGG - Intergenic
1097510659 12:60535342-60535364 CCAGAAGTATGTAAACAAATGGG - Intergenic
1100735436 12:97524362-97524384 ACATAGGTCTATACAGCAATTGG - Intergenic
1106660011 13:31789768-31789790 CCATTGTTATCTACAAAAATAGG + Intronic
1107050830 13:36047319-36047341 CCTTTGATATATACAGAAATGGG - Intronic
1110441752 13:75533849-75533871 CTATAGGAATGTTCAGAAAGTGG + Intronic
1112067160 13:95805413-95805435 GGATATGTATGTCCAGAAATAGG - Intronic
1118712246 14:68530088-68530110 TCATATGTATGTATAAAAATTGG - Intronic
1119565133 14:75622317-75622339 CCATGGATATTTACAGAAACTGG + Intronic
1120440107 14:84525814-84525836 AGATAGGTATGTAGAGAGATAGG + Intergenic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1121985272 14:98499249-98499271 ACATAGGTGTGTTAAGAAATAGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1127830572 15:62747282-62747304 CCATAAGTAGATACAGAATTGGG - Intronic
1130170255 15:81504691-81504713 CCATAGGTCAGTACAGATATGGG - Intergenic
1131288673 15:91085039-91085061 TTATAGGTATGTAAAAAAATTGG - Intergenic
1133472326 16:6087372-6087394 GTATATGTATCTACAGAAATAGG + Intronic
1134439215 16:14287578-14287600 GCATAGGCATGTATATAAATAGG + Intergenic
1141229443 16:82151267-82151289 CCATAGCTATTTAAAGAAATTGG - Intronic
1143173383 17:4943070-4943092 CCATAGGTGGGGACAGGAATGGG - Intronic
1144237422 17:13275245-13275267 TCATATGTATGGACAGGAATGGG - Intergenic
1145964411 17:28906672-28906694 CCACAGGTGTGTACACACATGGG + Intronic
1146115922 17:30138810-30138832 ACTTAGGGATGTAGAGAAATTGG - Intronic
1150360440 17:64528418-64528440 CCATGTGTATGTACATAAAAAGG - Intronic
1152056180 17:78028738-78028760 TAAAAGGTATGTACAGAACTAGG + Intronic
1159162788 18:64665476-64665498 ACATATGTGTGTACAGAGATAGG - Intergenic
1166022633 19:40046368-40046390 CCATAAATATGTACAAATATTGG + Intronic
1168400386 19:56082370-56082392 TCATAGGTAGATACATAAATAGG + Intergenic
929185395 2:39088942-39088964 CCATATGGATGTAAAGAAATTGG - Intronic
929203906 2:39268293-39268315 TAAAAAGTATGTACAGAAATGGG - Intronic
934546207 2:95218820-95218842 GCATAGGTGTGGAGAGAAATTGG + Intronic
934868029 2:97831512-97831534 ACATAGGTAGGTACAGATGTAGG + Intronic
937747076 2:125426960-125426982 CCATATGTATATACAGAGACTGG - Intergenic
939526240 2:143297973-143297995 ACATAGGAATGTAGAGGAATGGG - Intronic
940065707 2:149625853-149625875 TCATAAGTTTGTACAAAAATAGG - Intergenic
942160642 2:173182546-173182568 ACAAAGGTATGTATATAAATAGG - Intronic
942745873 2:179231957-179231979 CTACAGGGATGTACAGACATAGG + Intronic
943855794 2:192788471-192788493 CCAAATCTATGTACAAAAATCGG - Intergenic
945989844 2:216386555-216386577 CCATAGGTATATAAAGATGTGGG + Intergenic
946942757 2:224786838-224786860 CCATAGGAATGTACAAAGTTGGG - Intronic
947041454 2:225925875-225925897 CCATGGATATGTATAAAAATGGG - Intergenic
1170047731 20:12103810-12103832 CCATAGGTAACCACATAAATTGG - Intergenic
1170244426 20:14204925-14204947 CCATAGTTATGTAGAGTACTAGG - Intronic
1173365352 20:42380105-42380127 CCAAAGCTATCTACTGAAATAGG - Intronic
1182387832 22:29961389-29961411 CCATATGTATATACTGACATAGG + Intronic
949111808 3:270106-270128 CCATAGTTCTGGCCAGAAATGGG + Intronic
952237526 3:31495507-31495529 TCATAGGTAAGTACAGAAGTGGG + Intergenic
955866813 3:63392972-63392994 CCATAGGTATGTACAGAAATGGG - Intronic
956949824 3:74269540-74269562 GATTATGTATGTACAGAAATGGG - Intronic
957416105 3:79907584-79907606 CCATAGGAATCTGAAGAAATTGG - Intergenic
965264823 3:166529707-166529729 CCAAAGCTATGTACAGAAAGAGG + Intergenic
972509684 4:39756743-39756765 CCAAAGGTATGAAAAGTAATTGG + Intronic
976499333 4:85769509-85769531 ACATATGTATATACACAAATGGG - Intronic
977695547 4:99961089-99961111 TCACAGGTATGTAGAGACATAGG - Intergenic
979900624 4:126212451-126212473 ACAAATGTATGTACACAAATGGG + Intergenic
981347419 4:143692516-143692538 CCCTAGGTGTGTAAAGAAAGTGG + Intronic
981347902 4:143697863-143697885 ACATTGGGATGCACAGAAATTGG + Exonic
983273950 4:165595004-165595026 CAGTTGGTATGTACTGAAATAGG + Intergenic
984565559 4:181326037-181326059 GAATAAGTATATACAGAAATAGG + Intergenic
987037889 5:14036479-14036501 ATATAGGTATATATAGAAATGGG - Intergenic
988169115 5:27632146-27632168 CCATTGGTAAGTACTGACATGGG + Intergenic
988721819 5:33886753-33886775 CCATAGGTGTGGATGGAAATCGG + Intronic
990442184 5:55857660-55857682 CAGTAGGTTTGAACAGAAATGGG - Intronic
995328248 5:110916801-110916823 TAAGAGGTTTGTACAGAAATGGG + Intergenic
1000490816 5:161911125-161911147 CAACAGTGATGTACAGAAATAGG - Intergenic
1000853660 5:166372027-166372049 GCATATGTAGGTACAGACATAGG - Intergenic
1001337958 5:170816317-170816339 TTCTAGGGATGTACAGAAATGGG + Intergenic
1001751522 5:174135066-174135088 CCATTTGCAGGTACAGAAATGGG + Intronic
1004564650 6:16784736-16784758 CCAAAGGTATGATTAGAAATTGG + Intergenic
1009375948 6:62969168-62969190 CCTTAGGTTTGCAAAGAAATTGG + Intergenic
1009507473 6:64503192-64503214 CCATAGATATGTGAAGAAACTGG - Intronic
1011578003 6:88826139-88826161 CCAAAGGTATGAAAAGAAAAAGG + Intronic
1015062581 6:128984399-128984421 CCATTCGTATGTACTTAAATAGG + Intronic
1018663558 6:166112845-166112867 CCATAGGAGTGCAGAGAAATTGG - Intergenic
1020478329 7:8625666-8625688 CCAGAGGTTTGTTCAGAAACTGG + Intronic
1027453129 7:78355689-78355711 ACTTATGTATGTACAGACATGGG + Intronic
1029526488 7:101097782-101097804 CCATGGCAATGTAGAGAAATGGG - Intergenic
1030975541 7:116117750-116117772 CCATAGGTATCTAGAGAACTAGG - Intronic
1031019403 7:116610898-116610920 CCATAGCTATATTCAAAAATAGG - Intergenic
1031805651 7:126303592-126303614 CCTTAGGTATTTACAACAATAGG + Intergenic
1034452746 7:151146103-151146125 CCATGGGTATGTGTAGGAATAGG + Intergenic
1037191010 8:16125536-16125558 TCATAGAGATGTAAAGAAATGGG - Intronic
1039980844 8:42408903-42408925 CCACTGGTATAAACAGAAATTGG - Intergenic
1045148594 8:99376950-99376972 CATTAGGTATGTATAAAAATAGG + Intronic
1045853155 8:106727717-106727739 CCATAAGAATGAACAGAACTTGG - Intronic
1047774197 8:128055956-128055978 CAATATGCATGTACAGAAATGGG + Intergenic
1048076582 8:131078188-131078210 CCAAAAGGATGTAAAGAAATAGG - Intergenic
1048436043 8:134418787-134418809 CCTTAGGTATATACCCAAATGGG - Intergenic
1048730962 8:137440617-137440639 CCAGAGGTATGTTAAGAAACTGG + Intergenic
1053339325 9:37309478-37309500 CCAAAGGTATTTACATAAAAAGG - Intronic
1053840794 9:42187151-42187173 CCATAGGTGTGGGCAGGAATTGG - Exonic
1055014984 9:71606628-71606650 GCAAAGCGATGTACAGAAATTGG + Intergenic
1055893532 9:81148614-81148636 CCATAGATATTTAAAGATATTGG + Intergenic
1055978821 9:81980605-81980627 ACATAGATATGTAGAGAAATAGG - Intergenic
1056087675 9:83168139-83168161 TGATAGGGATGTGCAGAAATTGG - Intergenic
1057777033 9:98019596-98019618 CCACAGGTATATACATAAGTTGG + Intergenic
1058402096 9:104631432-104631454 ACATGGGTATGGACAGAAAAGGG - Intergenic
1188603304 X:31996122-31996144 ACATAGGCATGGAGAGAAATTGG + Intronic
1189937259 X:46082497-46082519 ACATAGGTAGGTACAGATCTTGG - Intergenic
1190855035 X:54285598-54285620 CCATAAATATGTAAACAAATAGG - Intronic
1192324273 X:70118971-70118993 ACATATGTATGTAATGAAATAGG - Intergenic
1193311870 X:80019804-80019826 CAACAGATATATACAGAAATGGG + Intronic
1197891807 X:131276641-131276663 CCATAAAAATGTGCAGAAATAGG + Intronic
1198847653 X:140930040-140930062 GCATATGTATGTATAGAAAAAGG - Intergenic
1199585796 X:149414606-149414628 CCATAGGCAAGAAGAGAAATGGG - Intergenic
1200285117 X:154813850-154813872 ACATAGGTATTTGCAGACATAGG - Intronic