ID: 955869175

View in Genome Browser
Species Human (GRCh38)
Location 3:63418549-63418571
Sequence TTCATAAATTACCCAGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43036
Summary {0: 127, 1: 3663, 2: 11886, 3: 14485, 4: 12875}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955869175_955869182 22 Left 955869175 3:63418549-63418571 CCCAAGACTGGGTAATTTATGAA 0: 127
1: 3663
2: 11886
3: 14485
4: 12875
Right 955869182 3:63418594-63418616 ACAGTTCCACGTGACTGGGGAGG 0: 45
1: 1158
2: 6120
3: 7523
4: 6990
955869175_955869181 19 Left 955869175 3:63418549-63418571 CCCAAGACTGGGTAATTTATGAA 0: 127
1: 3663
2: 11886
3: 14485
4: 12875
Right 955869181 3:63418591-63418613 CTCACAGTTCCACGTGACTGGGG 0: 33
1: 933
2: 5305
3: 8080
4: 8275
955869175_955869178 -5 Left 955869175 3:63418549-63418571 CCCAAGACTGGGTAATTTATGAA 0: 127
1: 3663
2: 11886
3: 14485
4: 12875
Right 955869178 3:63418567-63418589 ATGAAGAAAAAGAGGTTTAATGG 0: 44
1: 1427
2: 1782
3: 1377
4: 1987
955869175_955869180 18 Left 955869175 3:63418549-63418571 CCCAAGACTGGGTAATTTATGAA 0: 127
1: 3663
2: 11886
3: 14485
4: 12875
Right 955869180 3:63418590-63418612 ACTCACAGTTCCACGTGACTGGG 0: 34
1: 969
2: 5547
3: 8202
4: 8230
955869175_955869179 17 Left 955869175 3:63418549-63418571 CCCAAGACTGGGTAATTTATGAA 0: 127
1: 3663
2: 11886
3: 14485
4: 12875
Right 955869179 3:63418589-63418611 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955869175 Original CRISPR TTCATAAATTACCCAGTCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr