ID: 955869176

View in Genome Browser
Species Human (GRCh38)
Location 3:63418550-63418572
Sequence CTTCATAAATTACCCAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14898
Summary {0: 162, 1: 3698, 2: 4503, 3: 3314, 4: 3221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955869176_955869178 -6 Left 955869176 3:63418550-63418572 CCAAGACTGGGTAATTTATGAAG 0: 162
1: 3698
2: 4503
3: 3314
4: 3221
Right 955869178 3:63418567-63418589 ATGAAGAAAAAGAGGTTTAATGG 0: 44
1: 1427
2: 1782
3: 1377
4: 1987
955869176_955869182 21 Left 955869176 3:63418550-63418572 CCAAGACTGGGTAATTTATGAAG 0: 162
1: 3698
2: 4503
3: 3314
4: 3221
Right 955869182 3:63418594-63418616 ACAGTTCCACGTGACTGGGGAGG 0: 45
1: 1158
2: 6120
3: 7523
4: 6990
955869176_955869179 16 Left 955869176 3:63418550-63418572 CCAAGACTGGGTAATTTATGAAG 0: 162
1: 3698
2: 4503
3: 3314
4: 3221
Right 955869179 3:63418589-63418611 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
955869176_955869180 17 Left 955869176 3:63418550-63418572 CCAAGACTGGGTAATTTATGAAG 0: 162
1: 3698
2: 4503
3: 3314
4: 3221
Right 955869180 3:63418590-63418612 ACTCACAGTTCCACGTGACTGGG 0: 34
1: 969
2: 5547
3: 8202
4: 8230
955869176_955869181 18 Left 955869176 3:63418550-63418572 CCAAGACTGGGTAATTTATGAAG 0: 162
1: 3698
2: 4503
3: 3314
4: 3221
Right 955869181 3:63418591-63418613 CTCACAGTTCCACGTGACTGGGG 0: 33
1: 933
2: 5305
3: 8080
4: 8275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955869176 Original CRISPR CTTCATAAATTACCCAGTCT TGG (reversed) Intronic
Too many off-targets to display for this crispr