ID: 955869179

View in Genome Browser
Species Human (GRCh38)
Location 3:63418589-63418611
Sequence GACTCACAGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955869175_955869179 17 Left 955869175 3:63418549-63418571 CCCAAGACTGGGTAATTTATGAA 0: 127
1: 3663
2: 11886
3: 14485
4: 12875
Right 955869179 3:63418589-63418611 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
955869176_955869179 16 Left 955869176 3:63418550-63418572 CCAAGACTGGGTAATTTATGAAG 0: 162
1: 3698
2: 4503
3: 3314
4: 3221
Right 955869179 3:63418589-63418611 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955869179 Original CRISPR GACTCACAGTTCCACGTGAC TGG Intronic
Too many off-targets to display for this crispr