ID: 955870632

View in Genome Browser
Species Human (GRCh38)
Location 3:63434704-63434726
Sequence GGCTTTAAGAAATGTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955870627_955870632 20 Left 955870627 3:63434661-63434683 CCTTAATCATAGCAACAACTATT 0: 1
1: 0
2: 0
3: 16
4: 245
Right 955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG 0: 1
1: 0
2: 1
3: 20
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955870632 Original CRISPR GGCTTTAAGAAATGTGTGTT AGG Intronic
903267455 1:22166458-22166480 GGCTCTAAGAAATGAGTGGCGGG + Intergenic
903918748 1:26784404-26784426 GGCTTTAAATGATGAGTGTTTGG + Intergenic
904239115 1:29132615-29132637 GACACCAAGAAATGTGTGTTTGG + Intergenic
906817847 1:48897771-48897793 TCCTTTAAGAAATGTCTGTTCGG + Intronic
907362161 1:53926644-53926666 GACATTAAAAAATGTGTGTAGGG - Intronic
910564669 1:88630271-88630293 GACTTTTATAAATGTGGGTTTGG + Intergenic
912645221 1:111385941-111385963 GGCTTTATAAAATGTGACTTTGG + Intergenic
912777454 1:112514738-112514760 AGCTTTATGGAATGTGGGTTAGG + Intronic
913396956 1:118381901-118381923 GACATTAAGCAATGTGTCTTGGG - Intergenic
913414878 1:118593999-118594021 AGAATAAAGAAATGTGTGTTTGG + Intergenic
913415030 1:118595915-118595937 GGCATGATGAAATGTGTGATGGG - Intergenic
915389177 1:155525517-155525539 GGCTTTTAGAAATGTAGATTGGG - Intronic
916350768 1:163847317-163847339 GCCTTTTAGAAGTGTGTTTTGGG - Intergenic
917021339 1:170591471-170591493 AGCTTTAAGAAATGATTGTGTGG + Intergenic
917272717 1:173296312-173296334 GACTTTAATAAATATTTGTTGGG - Intergenic
918455534 1:184708797-184708819 TCCTTTAAGAAATTTGTGTCTGG + Intronic
919046090 1:192453993-192454015 GTATTTAAGAAATGTCTCTTTGG - Intergenic
920760039 1:208774783-208774805 GGCTGTAACAAATGTGTCTCTGG - Intergenic
921153333 1:212418778-212418800 GGCTTTTTGAAATGTCTTTTCGG - Intergenic
921936604 1:220801916-220801938 AGGTGTAAGAAATGTGTGTGGGG - Intronic
921947629 1:220896911-220896933 GCATTTTAGAAATGTGTTTTGGG + Intergenic
923637260 1:235711424-235711446 AGCTTTAAGAAGTTGGTGTTGGG - Intronic
1062845850 10:704388-704410 GGCTTTGAAAAGTGTGTGTTGGG - Intergenic
1063039276 10:2320228-2320250 GGTTTCAAGAAATGTTTGGTGGG - Intergenic
1064049392 10:12047192-12047214 GGCTTTAAATACTGTCTGTTCGG - Intergenic
1065459102 10:25937041-25937063 GGCCTTTAGAAATGTTTCTTTGG + Intronic
1065505685 10:26428096-26428118 GGTTTTAAGAAATGTGGACTTGG - Intergenic
1066179492 10:32946089-32946111 CGGGTTAAGAAATGTGTTTTAGG + Intronic
1067290626 10:44937032-44937054 GTGTTTTAGAGATGTGTGTTGGG + Intergenic
1067691328 10:48504135-48504157 GGCCTCATGAAATGTGTGTCAGG + Intronic
1067718495 10:48708327-48708349 GCCTTCAAGGAATGTGTGTTTGG + Intronic
1070344121 10:75525007-75525029 GGCTTTGGCAAATGTATGTTGGG - Intronic
1071859666 10:89659263-89659285 TGATATAAGAAATGTGTATTTGG - Intergenic
1072089010 10:92108629-92108651 GGGTCAAAGAAATGTGTGATTGG + Intronic
1073540034 10:104310657-104310679 TGCATTAACAAATGTGTGTGCGG + Exonic
1074510557 10:114108171-114108193 CGCTCTAAGAGATGTGTGTGAGG - Intergenic
1074879535 10:117644615-117644637 TTCTTTAAGAAATGTTTGTCTGG + Intergenic
1075365518 10:121884958-121884980 GGCTTTAAAAAATGTGCTTTAGG + Intronic
1076052003 10:127342566-127342588 GGATTTGAGAAAAGTCTGTTGGG - Intronic
1078339551 11:10489004-10489026 AGCTTTAAGAAGTGAGAGTTTGG + Intronic
1079195139 11:18319652-18319674 GAATTGAAGAATTGTGTGTTGGG + Intronic
1079452137 11:20606435-20606457 GGCGTTGAGAAGTGTGTGATGGG + Intronic
1079632484 11:22695017-22695039 GGCTTAAAAAAGTGTGGGTTCGG + Intronic
1080786562 11:35480203-35480225 GGCTTTAAAAATGGTTTGTTTGG - Intronic
1081271979 11:41095908-41095930 GGAGTTAACATATGTGTGTTTGG - Intronic
1081504308 11:43698931-43698953 TGCTTTAAAAAATCTGTTTTAGG - Intronic
1082653909 11:55829109-55829131 GGAATTAAGAAATGTGGTTTAGG - Intergenic
1085904526 11:80744195-80744217 GTATTTAAGAATTGTGTTTTTGG - Intergenic
1086222784 11:84469855-84469877 CATTCTAAGAAATGTGTGTTAGG + Intronic
1086491793 11:87363197-87363219 GGATTTAGGAAATCTGTGTCAGG + Intergenic
1087573960 11:99966736-99966758 TTCTCTAAGAAATGTGTGCTAGG - Intronic
1087897655 11:103604844-103604866 TGCTTTAAGAAAGGTGTTTGGGG + Intergenic
1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG + Intergenic
1088122351 11:106385281-106385303 TGCTTTATGTAATTTGTGTTAGG + Intergenic
1088214752 11:107495396-107495418 TGCTCTAAGAATTGTGTGTGTGG - Intergenic
1088980359 11:114857745-114857767 GCCTTTATGAAATGTGTGGCTGG + Intergenic
1091309284 11:134561223-134561245 GCCTTTCAGGAATGTGTGTGGGG + Intergenic
1092280186 12:7092377-7092399 GGCCTTGAGAAATGTGAGTAAGG - Exonic
1092452814 12:8618685-8618707 GGCTTTAGGAAATCTGTGCCAGG + Intergenic
1092453211 12:8622733-8622755 GCCATTAAGAAATATGTGATAGG - Intergenic
1092869707 12:12795422-12795444 TGCTTTAAGAATTGGGTATTTGG - Intronic
1093161575 12:15752999-15753021 GGCTTAAAGAAATGTGACTCAGG + Intronic
1095742236 12:45620163-45620185 GGGGTCAAGAAATGTGTGTCTGG + Intergenic
1097557464 12:61156947-61156969 GGCTTTAGGAAAAATGGGTTCGG + Intergenic
1100390426 12:94141901-94141923 AGCTTGGAGAAATGTGGGTTGGG + Intergenic
1101008800 12:100428717-100428739 CGTTTTAATAAATTTGTGTTGGG + Intergenic
1101665482 12:106809220-106809242 CGTTTTAAGAATTGTGTGGTGGG + Intronic
1102079959 12:110089950-110089972 GGATTTCAGAGATGTGTTTTGGG - Intergenic
1102305289 12:111800092-111800114 GGCTTTGAGGAATCTCTGTTGGG - Intronic
1103431784 12:120894019-120894041 GGTTATAAGAAATGAGTGTAGGG + Intronic
1103462883 12:121119104-121119126 GGATTTCAGAGATGTGTTTTGGG + Intergenic
1105661065 13:22495884-22495906 GGCTTAAAGTAAAGTGTGGTAGG - Intergenic
1105751173 13:23422532-23422554 GGTTTTATAAAACGTGTGTTTGG - Intronic
1105751225 13:23423342-23423364 GGTTCTAAAAAATGTGTGTTTGG - Intronic
1107562234 13:41567898-41567920 GGTTTTGAGAACTATGTGTTTGG - Exonic
1107915235 13:45143272-45143294 GGTTTAAAAAAATGTGTATTTGG + Intronic
1108505152 13:51106538-51106560 GGCGTTAAGAGATTTGTGTAAGG - Intergenic
1109213915 13:59565914-59565936 GGCATTAAGAGATGGGTCTTTGG - Intergenic
1109502066 13:63250586-63250608 GGCTTAAAAAAAAGTGTTTTAGG - Intergenic
1110519601 13:76459518-76459540 TTTTTTAAGAAATGTATGTTGGG - Intergenic
1112726973 13:102315804-102315826 AGCTTCAATAAATCTGTGTTAGG - Intronic
1112980047 13:105372399-105372421 TCCTTTAAGAAATGTCTATTCGG - Intergenic
1112997073 13:105587103-105587125 GGCAATAACAAATGTGGGTTAGG - Intergenic
1113397327 13:109960827-109960849 GGCTTTCAGAATTGTGTCTTTGG + Intergenic
1113456610 13:110453872-110453894 GCCTTTAGAAAATGTGTGTGTGG + Intronic
1114414941 14:22536153-22536175 GGCTTTCAGAAACTTGTATTTGG + Intergenic
1114983549 14:28195311-28195333 GTCTTTAAGATTTGTATGTTTGG - Intergenic
1115007516 14:28503632-28503654 GGCTTCAGCAAATCTGTGTTAGG + Intergenic
1116544274 14:46143619-46143641 TGATTTAAGAAATGTTTTTTGGG + Intergenic
1117580762 14:57149446-57149468 AGCTTTTAGAAATGTCTATTTGG - Intergenic
1117973451 14:61274790-61274812 GGTTTTTGGAAATGTGAGTTTGG + Intronic
1118519340 14:66564459-66564481 TGCTTTAAAAAATGGGTCTTGGG + Intronic
1119202603 14:72768377-72768399 GGATTTAAATAATGAGTGTTGGG + Intronic
1123508744 15:20973176-20973198 GGCACAGAGAAATGTGTGTTTGG - Intergenic
1123565968 15:21546925-21546947 GGCACAGAGAAATGTGTGTTTGG - Intergenic
1123602225 15:21984212-21984234 GGCACAGAGAAATGTGTGTTTGG - Intergenic
1124833353 15:33171907-33171929 GAATTAAAGAAATGTGTTTTTGG + Intronic
1125318043 15:38453393-38453415 GGATTTAAAAAATGTATTTTAGG - Intergenic
1125581937 15:40792037-40792059 GAATCTGAGAAATGTGTGTTTGG - Intronic
1125769883 15:42158081-42158103 GGCTCTAAGAAATGAGAGTCTGG + Intergenic
1126454710 15:48848590-48848612 GACTTTAATAAAAGTTTGTTTGG - Intronic
1127075386 15:55320136-55320158 GGCTTTAAGAATGGTGTGGAGGG + Intronic
1127366816 15:58299159-58299181 GCTTTTAAGAAATTTGTCTTTGG + Intronic
1127389488 15:58493956-58493978 GGTTTTAAGAAATGAGAGTAGGG + Intronic
1127669551 15:61182375-61182397 CTCTTTCAGAAATGTGCGTTTGG + Intronic
1127826979 15:62712853-62712875 TTCTATAAGAAATGTGTGCTAGG - Intronic
1128139477 15:65288151-65288173 GGCCTCAAGAATTGTTTGTTGGG + Intronic
1128914948 15:71551457-71551479 GGCTTGAAGGGCTGTGTGTTGGG + Intronic
1129781103 15:78271862-78271884 GGGTTTAAGAAGTGTGGCTTTGG + Intronic
1129805474 15:78453173-78453195 GTCTTGAAGAAATGTGAGATGGG + Intronic
1130829337 15:87583736-87583758 TCCTTAAAGAAATGTGAGTTTGG + Intergenic
1131735806 15:95330886-95330908 CACTTTAAGAAGAGTGTGTTTGG - Intergenic
1202974331 15_KI270727v1_random:274018-274040 GGCACAGAGAAATGTGTGTTTGG - Intergenic
1134318430 16:13140537-13140559 TGCTATAATAAATCTGTGTTGGG - Intronic
1139107803 16:63849505-63849527 TGTTTTTAAAAATGTGTGTTTGG + Intergenic
1139605406 16:68014643-68014665 GACCTTAAGAAATGTATTTTTGG - Intronic
1141920056 16:87129627-87129649 TGTTTTAAGAGATGTGTCTTTGG - Intronic
1142784214 17:2207825-2207847 TGCTTTAAAAACTGTCTGTTTGG - Intronic
1143347279 17:6259169-6259191 AGACTTAACAAATGTGTGTTGGG + Intergenic
1146995413 17:37316063-37316085 GGCTTTAGGAACTGTGTGCCAGG + Intronic
1147408982 17:40235537-40235559 GGCTTTATGAAAGGAGTCTTTGG + Intronic
1148909951 17:50936410-50936432 GGGTTTGAGAATTGTGGGTTGGG + Intergenic
1149630717 17:58120134-58120156 GGCTTAAATAAATATTTGTTGGG + Intergenic
1150175609 17:63051791-63051813 AGTTTTAAAAAATTTGTGTTAGG + Intronic
1153394089 18:4598257-4598279 GGCTTCAAGACAAGTGAGTTTGG - Intergenic
1159262487 18:66032451-66032473 AACTTTTAGAACTGTGTGTTTGG - Intergenic
1159791722 18:72789750-72789772 GGGATTAAGAAATGTGTTCTAGG - Intronic
1160204283 18:76820811-76820833 GAGTTTAAGAAGTGTGTGTGTGG - Intronic
1161244267 19:3240627-3240649 GGCTTTCAGAAGTGTGTGGTAGG - Intronic
1162615595 19:11798271-11798293 ATCTTTCAGAAATGTGTGCTGGG - Intronic
1165231061 19:34387069-34387091 GGCTGTAAGGAATCTGAGTTGGG + Intronic
935064310 2:99634646-99634668 AGCTTCAAGAAATATGTCTTAGG + Intronic
935375160 2:102388194-102388216 GGCTCTAAAACATGTGTGCTGGG - Intronic
935477717 2:103544121-103544143 TCTTTTAAGAAATGTCTGTTTGG + Intergenic
937135374 2:119547076-119547098 GGCTTTAAAAGATGAGTGGTGGG - Intronic
937689555 2:124739637-124739659 GTCTTTAGGAAATGACTGTTTGG - Intronic
939781406 2:146453355-146453377 GACTGTAAGAACTGTGTGGTTGG - Intergenic
940388080 2:153097534-153097556 ACCTTTAAGAAATATGTGTTAGG - Intergenic
941160470 2:162029190-162029212 GCATTTAATAAATGTTTGTTGGG + Intronic
941218800 2:162748794-162748816 GGATTAAAGATATGTCTGTTAGG - Intronic
941897149 2:170640482-170640504 CACTTTGAGAAACGTGTGTTGGG - Intronic
942354342 2:175092467-175092489 GGTTTTAAGAAATGTATCTGAGG + Intronic
942610409 2:177736916-177736938 GTCTTTAGGTATTGTGTGTTTGG - Intronic
943593456 2:189827249-189827271 GGAATAGAGAAATGTGTGTTTGG - Intronic
944173348 2:196802759-196802781 GAATTTTAGAAATGTGTGTAGGG + Intergenic
944269627 2:197767210-197767232 GGTTTTAAGTAATCTGTTTTGGG - Intronic
945208781 2:207360471-207360493 GGACTTGAGAATTGTGTGTTAGG + Intergenic
946748904 2:222872828-222872850 GGCTTGAAGCAATGTGGGGTGGG + Intronic
947232003 2:227897400-227897422 TGCTTTAGGATATATGTGTTGGG + Intronic
947270180 2:228326142-228326164 GACTTTACAAAAAGTGTGTTGGG - Intergenic
947908949 2:233789370-233789392 GGATCTAAGATTTGTGTGTTTGG + Intronic
948953021 2:241267259-241267281 AAGTTTAAGAAATTTGTGTTGGG + Intronic
1169431807 20:5542961-5542983 AGCTTTATGTTATGTGTGTTAGG - Intergenic
1169552770 20:6718170-6718192 TGATTTAAGAAATGTGTATATGG - Intergenic
1169563128 20:6823552-6823574 TGCTTTAAAATATGTGTCTTTGG + Intergenic
1169640816 20:7749937-7749959 CTCATTAAGAAATCTGTGTTAGG - Intergenic
1170302049 20:14895184-14895206 AGCTTAAAGGAATGTGTGTTGGG + Intronic
1171404090 20:24898096-24898118 GGTTTTAGGAGTTGTGTGTTAGG + Intergenic
1172125266 20:32621832-32621854 GACTTGAAGAAGTGTGGGTTGGG + Intergenic
1172294335 20:33797882-33797904 TCCTTTAAAAAATATGTGTTTGG - Intergenic
1172368451 20:34367967-34367989 TGTCTTAAGAAATTTGTGTTAGG + Intronic
1173090370 20:39964766-39964788 GGATTTAAGAACTCTGTGTCAGG + Intergenic
1173937122 20:46876525-46876547 GGCCTAAAGAAATGTTTGTGGGG - Intergenic
1175255035 20:57637987-57638009 GGCTTAAAGAGATGTGTATACGG + Intergenic
1176804968 21:13472027-13472049 GGATTTTACAAATGTGTGTGCGG + Intergenic
1177164277 21:17582090-17582112 GGCCTTAGGAAATGTGTGGCAGG - Intronic
1177173702 21:17681296-17681318 GTCTTTTAGAAATGTCTGTGAGG - Intergenic
1177545223 21:22547560-22547582 GGCTTTAAGAAATGTTAGAAAGG - Intergenic
1179000043 21:37449095-37449117 GAAGTTAAGAAATGTGTTTTCGG - Intronic
1184719274 22:46300394-46300416 GGCTTTAAGAAAAGAATTTTAGG - Intronic
1184760227 22:46539417-46539439 GGCTTTAAGCAGAGTGGGTTGGG + Intergenic
949104192 3:183621-183643 GCCTTCATGAAATGTCTGTTTGG + Intergenic
949197741 3:1333355-1333377 GGCATTAAAAAATGTGTACTGGG - Intronic
950113776 3:10437515-10437537 GGCGTTAAGAAGTGGGCGTTAGG - Intronic
950937913 3:16861668-16861690 GGATTTAATGACTGTGTGTTCGG + Intronic
952650750 3:35724235-35724257 TGCCTCCAGAAATGTGTGTTGGG - Intronic
953773742 3:45798319-45798341 GGCCTTAGGATAGGTGTGTTTGG + Intergenic
954185186 3:48911637-48911659 GCATTTAAGAAATGTGATTTGGG + Intergenic
954605636 3:51907048-51907070 GGTTTTAAAAAATGGGAGTTTGG + Intergenic
954887307 3:53887048-53887070 GGCTGCAAGAAATGTGGGTTAGG - Intronic
955293551 3:57714926-57714948 GGTTTTAAGAGCTGTGTGCTGGG - Intergenic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
955945908 3:64193382-64193404 GGCATTTGGAAATGTATGTTTGG - Intronic
956056842 3:65308192-65308214 GGTTTTAAAAAATGTATATTAGG - Intergenic
956472117 3:69578161-69578183 GACTTGAAGAAAAGTATGTTTGG - Intergenic
956616050 3:71173839-71173861 AGCTTTAAGGAATGGGAGTTGGG + Intronic
956887649 3:73576628-73576650 CTCTTTAAGAAACTTGTGTTTGG - Intronic
957341091 3:78897596-78897618 GCCATTTAGAAATGTGTTTTTGG - Intronic
957341864 3:78910019-78910041 GTCTTTATGAAATGTGTCTACGG - Intronic
958023498 3:88024516-88024538 GGCTTTAAGAAATCTGTGAGTGG - Intergenic
958164530 3:89862667-89862689 GGTTTTAGGAGCTGTGTGTTAGG - Intergenic
958739716 3:98054867-98054889 GGCTTTAGGAATAGTTTGTTAGG + Intergenic
958740252 3:98060546-98060568 GGCTTGCATAAATGTTTGTTGGG + Intergenic
960493026 3:118340458-118340480 GGTTTGAAGACATTTGTGTTAGG - Intergenic
961809752 3:129514957-129514979 GGGTTGAAGGAATGTGGGTTGGG - Intronic
963793992 3:149613167-149613189 GGTTTTAAGAGGTGGGTGTTGGG - Intronic
964341172 3:155709956-155709978 AGCTTTAAGAAGTGTTTGGTTGG + Intronic
964519219 3:157544854-157544876 CGCATTAAGAAATGTGTGTGAGG - Intronic
964730516 3:159859954-159859976 GGCTTAAAGAAATGTGTGACAGG + Intronic
965755254 3:172019635-172019657 ATCTTTAAGAAATGTATCTTTGG - Intergenic
967440701 3:189505141-189505163 AGTTTTGGGAAATGTGTGTTTGG - Intergenic
967456551 3:189693380-189693402 GGTTTTAATTAATGTGTATTTGG - Intronic
967552756 3:190817832-190817854 GGCTTTCAGAATTTTGTGTCTGG + Intergenic
967553394 3:190826076-190826098 GGATTAAAGAAATCTGTGTCTGG - Intergenic
968076618 3:195819288-195819310 GGCCTTCAGAAATGTGTGAATGG - Intergenic
968710100 4:2108299-2108321 GCCTTTAAGAAATGTGCCTGAGG - Intronic
969666837 4:8562931-8562953 GGCTTTAAAAAATTTTTGCTTGG + Intronic
970077590 4:12242183-12242205 GGCTTTTGGAAATGCCTGTTTGG - Intergenic
971226671 4:24760183-24760205 AGCTGTAAGAATTTTGTGTTTGG + Intergenic
971526736 4:27629040-27629062 GTCTTTAAAACATGTTTGTTAGG - Intergenic
972498841 4:39658903-39658925 AGATATAAGAAATTTGTGTTAGG + Intergenic
974309107 4:60181228-60181250 TGATTTAATAAAAGTGTGTTGGG - Intergenic
975374489 4:73628262-73628284 GGCCTTTTAAAATGTGTGTTTGG + Intergenic
975775364 4:77780729-77780751 GACTTTAATAAATTTGTCTTTGG + Intronic
976316558 4:83664835-83664857 TTCTTTAAAAAATATGTGTTTGG - Intergenic
976382030 4:84410405-84410427 AGGTCTAAGAAATGTCTGTTTGG + Intergenic
978173235 4:105699307-105699329 GGATTTAAAACAGGTGTGTTTGG + Intronic
979044389 4:115843443-115843465 GGCTTTAAGAAGTGAGTACTCGG + Intergenic
979191558 4:117865721-117865743 TCCTTTAAGATATGTGTGTGAGG + Intergenic
980170680 4:129286042-129286064 TGCTTTAAGAAAAATGTGGTTGG + Intergenic
980281186 4:130722495-130722517 GGCTTTAACATATGAATGTTGGG - Intergenic
980872865 4:138630034-138630056 AGCTGTAAGAAATATGTCTTGGG - Intergenic
980954308 4:139412911-139412933 TCCTTTGAGAAATGTCTGTTTGG + Intronic
981142574 4:141286581-141286603 GTTTTTAATAAATGTTTGTTAGG + Intergenic
982568663 4:157020880-157020902 GTTTTAAAGAAATGTGTGATTGG - Intergenic
982700518 4:158656178-158656200 GGATTTAAGAGATGTGTATGAGG - Intergenic
982913109 4:161170596-161170618 GGTTTCCAGAAATGTGTGTGAGG - Intergenic
983722941 4:170880848-170880870 TTCTTCAAGAAATCTGTGTTTGG + Intergenic
983897520 4:173097909-173097931 TGATATAATAAATGTGTGTTTGG + Intergenic
983951341 4:173646360-173646382 TGCTTTAGGAAATTTGTGTTGGG + Intergenic
986042359 5:4005804-4005826 GGCTTTAAGTAAAGTGGGTTTGG - Intergenic
986841246 5:11700004-11700026 GGTTTTAAAATATGTGTGTGGGG + Intronic
987244361 5:16033577-16033599 GGCTTTAATATATGAGTTTTGGG - Intergenic
987364087 5:17133175-17133197 GGAGTTAAGAAATGGGTGTTTGG + Intronic
988460455 5:31432051-31432073 GACTTTCAGAAGTTTGTGTTAGG - Intronic
988669736 5:33368476-33368498 GGCTTAAGGAAATGTGTGGCTGG + Intergenic
989220307 5:38952462-38952484 GGCTTTAAGAAATCTCAGCTTGG - Intronic
989379144 5:40797207-40797229 TGTTTTAAGAAAGGTGTATTGGG - Intronic
989822787 5:45815599-45815621 GCATTTAAGACATATGTGTTAGG - Intergenic
991376526 5:65973808-65973830 GGGATTAAGAAATGTTTTTTAGG + Intronic
991697643 5:69288125-69288147 AGTCTTAAGAATTGTGTGTTAGG - Intronic
992325714 5:75657605-75657627 GTCTTTAAGAAATGCTTTTTGGG + Intronic
993205376 5:84871987-84872009 GGCTCCAATAAATGTGTGGTTGG + Intergenic
993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG + Intronic
994491568 5:100452030-100452052 TTCTTTGAGAAATGTCTGTTCGG - Intergenic
994655539 5:102588449-102588471 GGAGTTAAGAAATTTGTGTGTGG + Intergenic
994680932 5:102887051-102887073 GACATTAAGAAATATTTGTTAGG + Intronic
996303502 5:122017881-122017903 TGCTTTATTAAATGTGTATTGGG + Intronic
998618003 5:143761942-143761964 GGCAATCAGAAATGTGGGTTTGG + Intergenic
1000116743 5:158160835-158160857 GAGGTTAAGAAATGTGTGCTAGG + Intergenic
1001308335 5:170592477-170592499 GGTTTCATGAAATGTGCGTTAGG - Intronic
1002631909 5:180587856-180587878 TGCTTTAAAGAATTTGTGTTTGG + Intergenic
1003445992 6:6184853-6184875 GGCTTTTGTATATGTGTGTTGGG + Intronic
1007850120 6:44794569-44794591 GGCTTAAGGAAAAGTGAGTTTGG - Intergenic
1007966357 6:46006971-46006993 TGCTTTAAAAAATGTCTTTTGGG - Intronic
1008022789 6:46600020-46600042 GGTTTTAGGAGATCTGTGTTAGG - Intronic
1009992395 6:70860047-70860069 TGCTTTAAGAAATATTTGTATGG + Exonic
1010478746 6:76322918-76322940 GGCTTTTAGAAATTTTTATTTGG - Intergenic
1010736535 6:79450271-79450293 AGTCTTAAGAAATGTGTGTGTGG + Intergenic
1011125622 6:84004017-84004039 GGTTTTAAGAAATGAATGTGGGG - Intergenic
1011930947 6:92712002-92712024 GACTTTAAGGAATGTGACTTAGG + Intergenic
1012287016 6:97402735-97402757 GGCTTTAAGAAATGTCAGTGTGG - Intergenic
1013943225 6:115691288-115691310 GGCTTTAAAATATGGGTTTTGGG - Intergenic
1014557412 6:122851229-122851251 GGCATTTAGATATATGTGTTTGG + Intergenic
1014976062 6:127885812-127885834 GACTTTTACAAATGTGTGTGTGG + Intronic
1015740049 6:136444139-136444161 GGCTTTGTGAAATGTTGGTTAGG - Intronic
1016020410 6:139231147-139231169 GGTTTTATGAAATGTGTGTGTGG - Intergenic
1016353686 6:143195005-143195027 GGGTTAAATAAATATGTGTTGGG - Intronic
1017554824 6:155551721-155551743 GCCTTAAATAAATGTTTGTTGGG - Intergenic
1018192576 6:161323349-161323371 GGCTAGGAAAAATGTGTGTTGGG + Intergenic
1020876433 7:13700533-13700555 AGTTCTTAGAAATGTGTGTTAGG + Intergenic
1021786818 7:24160502-24160524 GGCCTCAAGAGATTTGTGTTTGG + Intergenic
1023512798 7:40970974-40970996 GGGTTAAAGGAGTGTGTGTTGGG + Intergenic
1024631772 7:51255030-51255052 AGCTTTCAGAAATATATGTTTGG - Intronic
1025708095 7:63885609-63885631 GGCTTTAAGGAATTTGGCTTAGG - Intergenic
1026793426 7:73350028-73350050 GGTTTTAGGAACTGTGTGTCAGG + Intronic
1027377289 7:77564317-77564339 GGTTTTAAGAAATTTTGGTTTGG + Intronic
1027385194 7:77652985-77653007 GGCTTTAAAACATATGTCTTGGG - Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1029800610 7:102943351-102943373 AGCTTTAAAAAATGTATTTTGGG - Intronic
1030327488 7:108236093-108236115 AGCTTTGAGAAATGTTTGGTTGG - Intronic
1032514675 7:132497981-132498003 GGCTTAGAGAAAAGTGTATTGGG + Intronic
1032756749 7:134898097-134898119 GGGTTTAAGAAAAGTTTTTTTGG + Intronic
1034480291 7:151314661-151314683 GGCTTTTAGAAATGGGTGCCTGG + Intergenic
1035601537 8:900016-900038 GTCTTTAAGACCTTTGTGTTTGG + Intergenic
1036138345 8:6182506-6182528 GGCTGTAAGGAATGTGTGTTTGG - Intergenic
1036433928 8:8715284-8715306 GGCCTGAAGAATTGTGGGTTGGG + Intergenic
1037371765 8:18187470-18187492 GGCTTTTAAAAATGTGTATGTGG + Intronic
1037392195 8:18405054-18405076 GGCTTTAACATATGAATGTTGGG - Intergenic
1038920929 8:32083317-32083339 GGCTTTAGGCCAAGTGTGTTGGG + Intronic
1038963888 8:32549920-32549942 TGCTTCATGAAATGTGTGTTGGG - Intronic
1041323855 8:56643863-56643885 TACTTTAAGAAATGGGAGTTGGG + Intergenic
1043504705 8:80890883-80890905 TGATTTAAAAAATGTGGGTTGGG + Intergenic
1046490567 8:114947261-114947283 GCCTTTAAGAAATATCTGTGTGG - Intergenic
1046562333 8:115853620-115853642 GGCTTAGAAAAATGTGTGATAGG - Intergenic
1047882584 8:129212685-129212707 GGCTTTGGGATGTGTGTGTTGGG + Intergenic
1048105236 8:131401124-131401146 TTGTTTAATAAATGTGTGTTTGG - Intergenic
1050042618 9:1511963-1511985 GGCAGTAAGAACTGTGTGTCAGG + Intergenic
1050872361 9:10589188-10589210 GGATTTCAGAAATGTCTGTGTGG + Intronic
1052286072 9:26787087-26787109 GGCATTAAAAAAAGTGTGTGTGG + Intergenic
1055045146 9:71916322-71916344 GGCTCTAAGAAATATATTTTGGG - Intronic
1056337420 9:85587009-85587031 GGGTTTAAGAAATGTATATAAGG - Intronic
1056980034 9:91301299-91301321 GGTTTTAAGAGCTGTGTGTCTGG - Intronic
1060582652 9:124765254-124765276 TTCTTTAAGGAGTGTGTGTTTGG - Intronic
1060755577 9:126210768-126210790 GGCTTTTTGAAATCTGTGTGTGG - Intergenic
1186214679 X:7286981-7287003 CACTTTCAGAATTGTGTGTTTGG + Intronic
1188531584 X:31146878-31146900 GGCTTAAAGAACTATGTGTTAGG + Intronic
1189024056 X:37372263-37372285 GTCTTTGAGAAATGTCTGTCAGG + Intronic
1192053243 X:67746294-67746316 GCCTTTAGTAAATGTGTGTGGGG + Intergenic
1192130022 X:68541075-68541097 GGAGTTGAGAAATGTTTGTTGGG - Intergenic
1192803660 X:74491940-74491962 AGATTGAAGAAATCTGTGTTGGG - Intronic
1194078914 X:89433164-89433186 GGCTTTAAGAACTCTGTTTGAGG - Intergenic
1194897037 X:99455773-99455795 GGCTTTAATAAATGTTACTTTGG + Intergenic
1194943961 X:100046415-100046437 GGCTTTAGAATATGTGTTTTTGG - Intergenic
1195240167 X:102943653-102943675 GTCTTTTTGAAATGTATGTTTGG + Intergenic
1195896819 X:109753818-109753840 GCCTTTAAGAAATCCTTGTTGGG + Intergenic
1197179429 X:123518303-123518325 TGCTGTTAGAAATGTCTGTTGGG + Intergenic
1198311550 X:135429401-135429423 GGCTGAAAGAAATGTAGGTTGGG + Intergenic
1199266734 X:145836866-145836888 CTTTTTAAGAAATGTGTATTCGG + Intergenic
1200431538 Y:3088486-3088508 GGCTTTAAGAACTCTGTTTGAGG - Intergenic