ID: 955870722

View in Genome Browser
Species Human (GRCh38)
Location 3:63435729-63435751
Sequence TGTATATGTGAGAATATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955870722_955870723 2 Left 955870722 3:63435729-63435751 CCATCTATATTCTCACATATACA 0: 1
1: 0
2: 3
3: 35
4: 448
Right 955870723 3:63435754-63435776 AATTTCATCAAAATATTTGATGG 0: 1
1: 0
2: 5
3: 74
4: 870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955870722 Original CRISPR TGTATATGTGAGAATATAGA TGG (reversed) Intronic
900122092 1:1053016-1053038 TGTATGTGTGTGAACATGGAGGG + Intronic
900715920 1:4143756-4143778 TGCATATATGAGAAGATAAATGG - Intergenic
901166936 1:7228063-7228085 TTTTTATGTGACAATTTAGAAGG + Intronic
901335020 1:8441710-8441732 TGTTTATGTGAGTAAGTAGATGG - Intronic
906000494 1:42420490-42420512 GTTGTATGTGAGAATATAAATGG - Exonic
907138832 1:52165467-52165489 TGCATGTGTGTGTATATAGAAGG + Intronic
907175431 1:52517173-52517195 TGTAAATGTGAGATAATAGAGGG - Intronic
908172384 1:61518480-61518502 TGTAAATGTAAGAATATAGAAGG + Intergenic
908711025 1:67014478-67014500 TGTATATATAAAAATATAGATGG - Intronic
908798222 1:67852661-67852683 TGTTGAAGTTAGAATATAGAGGG + Intergenic
908875836 1:68674615-68674637 TATATATGTGTGCATATATATGG + Intergenic
909145356 1:71923483-71923505 TGTATATGTGTGAATGTGCACGG + Intronic
909301992 1:74024168-74024190 TGTATATGTTTGAATGTATAGGG + Intergenic
909584974 1:77279957-77279979 TCTATGTGTGGGTATATAGAAGG - Intergenic
911231915 1:95370795-95370817 TGTTTATGTTAGAGAATAGAGGG + Intergenic
912621286 1:111161605-111161627 TTTATATGTGAAAATAAAAATGG - Intronic
914345810 1:146797747-146797769 TGTATATTTAAAATTATAGAAGG + Intergenic
917078626 1:171233895-171233917 AGAATATGAGAGCATATAGATGG - Intergenic
917786537 1:178464589-178464611 TGTGTGTGTGTGAATATACATGG + Intronic
918841368 1:189543762-189543784 TGTAGATGTGATAGTACAGAAGG - Intergenic
919251612 1:195063720-195063742 GGTATATGTGAAAATTTTGATGG + Intergenic
919317585 1:195993080-195993102 TTTAGAAGTGAGAATATAAAAGG + Intergenic
921241101 1:213183992-213184014 TGTAAATTTGATAATTTAGATGG + Intronic
922053580 1:222018701-222018723 TGAATCTGTGAAAATATAGTTGG - Intergenic
922091943 1:222404087-222404109 TGTATGTGTGGGAATACACAGGG - Intergenic
922131607 1:222786076-222786098 TGTCTATGTGTGTATATATATGG + Intergenic
923581256 1:235216277-235216299 TGTATATCTCAGATTATAGCTGG - Intronic
923897547 1:238288927-238288949 TGTATATATAAAAATACAGAGGG - Intergenic
924151937 1:241138442-241138464 TGTATAGGGGAGAGTAAAGAGGG + Intronic
924169389 1:241321735-241321757 TGTATATAATAGATTATAGAAGG - Intronic
924329200 1:242925383-242925405 TGTTTGTGTGAGAAGAGAGAGGG - Intergenic
924501400 1:244642093-244642115 TGTATATGTGTGGGTGTAGATGG + Intergenic
924713266 1:246549004-246549026 TGAATATGTTAGAACATATATGG + Intronic
924843277 1:247737243-247737265 TGCATATGTGTGTATAGAGAAGG + Intergenic
1062810125 10:457030-457052 TGGATATGTGAGCAGAGAGATGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063100212 10:2943921-2943943 TGTATTTTTCAGAAAATAGAGGG + Intergenic
1063849650 10:10172282-10172304 GGTATAGGTGAGAATAATGAAGG - Intergenic
1064941061 10:20736012-20736034 TCTATATATGTGAATATAGATGG - Intergenic
1065932845 10:30494621-30494643 TGAATATCTGAGAAAATAAAGGG + Intergenic
1067158937 10:43806463-43806485 AGTATGTGTGAAAATCTAGAAGG + Intergenic
1068102911 10:52579116-52579138 GATATCTGTGAGAATTTAGAAGG + Intergenic
1068174810 10:53444710-53444732 TGTTTATTTGATAAGATAGAGGG + Intergenic
1068871669 10:61951758-61951780 TGTATCAGTGAGAATTTATATGG + Intronic
1068916462 10:62437642-62437664 CGTATATGTGTGAATTTAGAAGG - Intronic
1069158340 10:65055712-65055734 AGTCTAAGTTAGAATATAGAAGG - Intergenic
1070144265 10:73762293-73762315 TGTATAAGTGAGTATCTAGAAGG - Intronic
1070180507 10:74009141-74009163 AGTATATGTTTGAATATAGTGGG + Intronic
1070468046 10:76744628-76744650 TGTGGATGTGAGACTATATATGG + Intergenic
1071131626 10:82400333-82400355 TGCATAGGTGAGAATATGAATGG + Intronic
1071191576 10:83107878-83107900 TGTTTATGTGACAATCTAGATGG - Intergenic
1071263277 10:83940481-83940503 TGGATAAATGAGAATATTGAAGG - Intergenic
1071679224 10:87687958-87687980 TGTATATGAAAGAAAATAGGTGG - Intronic
1071753159 10:88504275-88504297 TGTACCTGTGAGAAAAAAGAAGG + Intronic
1071908193 10:90198371-90198393 TGGATGTGTGACACTATAGATGG - Intergenic
1071976667 10:90962630-90962652 TGTATATGTGGGGAAATGGAGGG + Intergenic
1073236500 10:102021248-102021270 TGTATTTTTAAAAATATAGATGG + Intronic
1075040114 10:119101397-119101419 TTTATAGGTAAGAATATAAAGGG - Intergenic
1076491518 10:130864867-130864889 TGTATAGGTGAGACAACAGAGGG - Intergenic
1076779325 10:132715332-132715354 TGTATTTGTGAGAAAATAATGGG - Intronic
1077929874 11:6720070-6720092 TGTAGATGTGAGGATCCAGAAGG + Intergenic
1077963759 11:7104907-7104929 TGAATATGTGATGATATCGAGGG - Intergenic
1079526417 11:21394429-21394451 TATATATGTGTGTATATATATGG + Intronic
1080259375 11:30329982-30330004 TGTTTATGAGAAAATAAAGAAGG - Intronic
1080928042 11:36778586-36778608 TGAATATATGAAAATATTGATGG + Intergenic
1080951327 11:37036541-37036563 TGTGAATGTGGGGATATAGAAGG + Intergenic
1081000873 11:37668963-37668985 TGTATATGTAAGTCTATTGATGG - Intergenic
1081588298 11:44402806-44402828 TGTAAGTGTCAGAAAATAGAAGG - Intergenic
1083836073 11:65268834-65268856 TGTATAAGTGGAAATATAGTAGG - Intronic
1084164322 11:67367933-67367955 TGTATATGTGTGTACATGGAGGG + Intronic
1085073110 11:73566254-73566276 TATATATGTGAAAATAGAAAAGG - Intronic
1085815534 11:79733327-79733349 GTTATATGAGAGAACATAGAGGG + Intergenic
1085844288 11:80048083-80048105 GGTATGTGTGTGCATATAGAAGG + Intergenic
1085878552 11:80438196-80438218 TGTGTGTGTGAGGAAATAGAGGG - Intergenic
1086568663 11:88257495-88257517 TGTGTGTGTGGGAACATAGATGG - Intergenic
1087749123 11:101986755-101986777 AGTATATGTAAGTATATATAAGG + Intronic
1087827947 11:102787562-102787584 AGTATATGTGTGTATATAAATGG + Intergenic
1088263999 11:107972384-107972406 TATATATGGTACAATATAGAGGG + Intergenic
1088850605 11:113700309-113700331 GGTATTTGTGGGAATATACAGGG - Intronic
1088911317 11:114194556-114194578 TGTATTTGTCATAATATAAAAGG - Intronic
1088934228 11:114382675-114382697 TGTCTTTGTGGGAATATGGATGG - Intergenic
1089043115 11:115472693-115472715 TGTGCATGTGAGAACACAGATGG - Intronic
1090891722 11:130929472-130929494 TATATATGTGTGAATACATATGG + Intergenic
1091099100 11:132853739-132853761 TGTACATGTTAGAACATGGATGG - Intronic
1091113375 11:132992257-132992279 TGTATGTGTGTGTATATATATGG - Intronic
1091414013 12:264459-264481 TGCATATGTGAGGACACAGAAGG - Intergenic
1092622927 12:10293156-10293178 TGTATATGTGTATATATATATGG - Intergenic
1093180450 12:15961290-15961312 TGTATCTGTGTGTATATGGATGG + Intronic
1093298534 12:17422614-17422636 TGTATATGTATGAATATATTTGG + Intergenic
1093684086 12:22036732-22036754 TGTATATGTGTACATATACATGG - Intergenic
1094763721 12:33565832-33565854 TGAATCTGTGAGGATATGGAAGG + Intergenic
1095672762 12:44879118-44879140 TGAAGATGGGAAAATATAGAAGG + Intronic
1095853337 12:46833272-46833294 TGGATGTGTGAGAATACAAAAGG - Intergenic
1096324280 12:50645424-50645446 TGTATTTGTGCAAATATGGAAGG + Intronic
1098591400 12:72218187-72218209 TGTATAAGTGAGATTTTAAAGGG + Intronic
1098699183 12:73601799-73601821 TGTATATGTGAATATACACAAGG + Intergenic
1098849068 12:75572994-75573016 TGTATGTGTATGTATATAGAGGG + Intergenic
1099016595 12:77350733-77350755 TGTATATGGGAAAATAGTGAGGG + Intergenic
1099293935 12:80806347-80806369 TCTATATTTGATAATATTGAAGG - Intronic
1099575801 12:84380150-84380172 TATATATGTGAGAATACAATAGG - Intergenic
1099752482 12:86794020-86794042 TATATATGTTTGAATTTAGAGGG - Intronic
1100166049 12:91919142-91919164 TGTATATTTAAGATTAAAGAAGG - Intergenic
1100577298 12:95905050-95905072 AGTATATGGGAGAATGTACATGG - Intronic
1102262756 12:111454705-111454727 TGAATATGTGAGAGTAAAAACGG - Intronic
1103867704 12:124066063-124066085 TGTATATTTGTTGATATAGAAGG - Intronic
1104530236 12:129563392-129563414 TGCATAGCTGAGGATATAGATGG + Intronic
1104662666 12:130622496-130622518 TATATATTTGATAATAGAGATGG + Intronic
1104699961 12:130895402-130895424 TCCACATGTGTGAATATAGAGGG + Intergenic
1106245079 13:27942298-27942320 TATACAGGGGAGAATATAGATGG + Intergenic
1106375437 13:29182304-29182326 TGTATAGATGAAAATAAAGAAGG - Intronic
1106567036 13:30895204-30895226 TGCATATGTGTGTATATATATGG + Intergenic
1106634268 13:31510342-31510364 AGTATCTGTGAGAATCAAGAAGG + Intergenic
1106921909 13:34573174-34573196 TTTATATGGGAGGAAATAGAGGG + Intergenic
1108516412 13:51207246-51207268 CATATATGTGAGTATATGGATGG + Intergenic
1108863664 13:54895317-54895339 TGTTCAAGTGAAAATATAGATGG - Intergenic
1108930930 13:55817513-55817535 TCTGTAAGTGAGAATATACATGG + Intergenic
1109127804 13:58540026-58540048 TATATATGTGTGTATATATATGG - Intergenic
1109144831 13:58766317-58766339 AGTCTATGTTAGAATATGGAAGG - Intergenic
1110089360 13:71425499-71425521 TTTGTATGCAAGAATATAGAGGG + Intergenic
1111175654 13:84592134-84592156 TTTATATGTGAGAAAATGGCTGG - Intergenic
1111928522 13:94488771-94488793 TGTATATGTATGTATATATATGG - Intergenic
1111928523 13:94488820-94488842 TGTATATGTATGTATATATATGG - Intergenic
1112848578 13:103674541-103674563 TGTATGTGTGTGAATATATCTGG - Intergenic
1113048357 13:106181204-106181226 TACATATGTGAAAATATATATGG - Intergenic
1113721219 13:112558715-112558737 TATAGATGTGAATATATAGAGGG - Intronic
1116141224 14:40996853-40996875 TGTATATGTGAAATTATTGGTGG + Intergenic
1116708494 14:48334929-48334951 TGTATATGTGTGAGAGTAGATGG + Intergenic
1117938228 14:60931742-60931764 TATATATGTGTGTATATATATGG + Intronic
1118352756 14:64985339-64985361 TGTATGTAGGAGATTATAGAAGG - Intronic
1120016811 14:79483333-79483355 TGGATATAAGAGAACATAGACGG + Intronic
1120317213 14:82910691-82910713 TGTATGTGGGATAATAAAGATGG - Intergenic
1120588709 14:86348876-86348898 TGTAAATGTGAGAACATTGGTGG + Intergenic
1121545994 14:94764072-94764094 TGTATATGTGAGACTGAAGTGGG - Intergenic
1123879798 15:24666834-24666856 TGTATATGGGAGAGTTGAGAAGG - Intergenic
1123915814 15:25025645-25025667 TATATATATGAGAGTATTGAAGG + Intergenic
1124501728 15:30233836-30233858 GGTATATGTGAGCATAAAGATGG - Intergenic
1124741837 15:32304815-32304837 GGTATATGTGAGCATAAAGATGG + Intergenic
1127341370 15:58048373-58048395 TGGATATGTGAGAAGCTAGGTGG - Intronic
1127646882 15:60967728-60967750 TATTTATGTGAGTAAATAGAAGG + Intronic
1128427581 15:67557861-67557883 TGTATATGTAAAAATATAAAGGG + Intronic
1128623134 15:69169373-69169395 TGTATATGTGTGTATATATATGG - Intronic
1129129145 15:73475930-73475952 TGTATATCTAAGCATAGAGAAGG - Intronic
1130236826 15:82142974-82142996 TGTATATATGAGAATCCATAGGG - Intronic
1130337358 15:82967953-82967975 TGTATATGTGTAAATATAATAGG + Intronic
1131349983 15:91691048-91691070 TGTATATGTAGTAATATATATGG + Intergenic
1131354077 15:91728893-91728915 TGAATAAATGAGAATATGGAGGG - Intergenic
1131645845 15:94342764-94342786 TGTATGTGTGTGTATATATATGG - Intronic
1131771171 15:95739122-95739144 TGAATATGTGTGAATATAACTGG - Intergenic
1131946532 15:97628371-97628393 TGTATATGTAAGTATACATAAGG - Intergenic
1132236212 15:100223818-100223840 TATATATGTGTGTATATATATGG + Intronic
1133172973 16:3993077-3993099 AGTTTATGAGAGAATATAGACGG - Intronic
1134274437 16:12763056-12763078 TGTATTTTTTAGAATAGAGATGG - Intronic
1137907660 16:52340250-52340272 GGTATATGTTATATTATAGATGG + Intergenic
1139208027 16:65047922-65047944 TGGATCTGTGAGAACATAGAGGG - Intronic
1139546122 16:67650428-67650450 CGTATATGTGAGGACAGAGATGG - Intronic
1139745610 16:69072095-69072117 TGTGTATGTGTGAAGAGAGAGGG + Intronic
1139988175 16:70917520-70917542 TGTATATTTAAAATTATAGAAGG - Intronic
1140052175 16:71491432-71491454 TTTATAGGTGAGAAAATTGAAGG - Intronic
1140545367 16:75802813-75802835 TGTTTTTGTGAGAAAATAGATGG - Intergenic
1141418428 16:83895478-83895500 TGTGTATGTGTAAATATATATGG - Intergenic
1144723416 17:17487809-17487831 TGTATATGTGTTAACATGGAAGG + Intronic
1146534230 17:33636113-33636135 TGTATATGTGTGAATATATGTGG + Intronic
1148517940 17:48239394-48239416 TGTGAATGTGATAATAAAGAGGG - Intronic
1149034930 17:52123348-52123370 TGTGTATGTGTGTATATATATGG + Intronic
1149085164 17:52708154-52708176 TGTATATTTTAAAATAAAGAAGG + Intergenic
1149430940 17:56595117-56595139 TGTATATGTGTGTGTATATACGG + Exonic
1150869334 17:68888071-68888093 TGTATGTGTGTGTATATATATGG - Intronic
1151099504 17:71540537-71540559 TGTGTAGGTGAGAATAAAGTAGG - Intergenic
1153593307 18:6697662-6697684 CATATATGAGAGAAAATAGATGG - Intergenic
1155318882 18:24598613-24598635 TCTACATGTGAGAATGTTGATGG + Intergenic
1155561551 18:27083112-27083134 TGTATATATAAGTAGATAGATGG + Intronic
1156388499 18:36628218-36628240 TGTACAAGTGAGAAAACAGATGG + Intronic
1157592939 18:48846676-48846698 TGAATAGGTGAGTAGATAGATGG + Intronic
1157927496 18:51782170-51782192 TTTATATGTGACAATATATGTGG - Intergenic
1158586386 18:58739791-58739813 TGTGTATGTGTGTACATAGAGGG - Intronic
1158727516 18:59987003-59987025 TGTATATGTGGGAATGTATCAGG + Intergenic
1159335903 18:67066042-67066064 TGTATATTTGGGTATATAGTAGG + Intergenic
1159675916 18:71284147-71284169 TGTATATGTGGTAAGAAAGACGG + Intergenic
1159819992 18:73129150-73129172 TGTATATGTTTCAATATAAATGG + Intergenic
1162173412 19:8809949-8809971 TGTATATGAGAGAACTTATATGG - Exonic
1163383919 19:16987259-16987281 TGTATATATGTGCATATATATGG - Intronic
1167171863 19:47838754-47838776 TGTATGTATGATCATATAGATGG + Intronic
1168014290 19:53558874-53558896 TGTATATGTGTGTATATATGGGG - Intronic
1168014298 19:53558992-53559014 TGTATATGTGTGTATATATGGGG - Intronic
1168014337 19:53559608-53559630 TGTATATGTGTGTATATATGGGG - Intronic
1168014370 19:53560131-53560153 TATATATGTGTGTATATATATGG - Intronic
1168014374 19:53560204-53560226 TATATATGTGTGTATATATATGG - Intronic
1168502342 19:56903973-56903995 TGTATATGTGTGTATATAGATGG - Intergenic
925699478 2:6619915-6619937 TGTATAAGTATGTATATAGAGGG + Intergenic
925942198 2:8831328-8831350 TGTAGATGTGACTATGTAGAGGG - Intronic
926856568 2:17262777-17262799 TGTGTATGTGTGTATATAAAGGG + Intergenic
927324826 2:21792067-21792089 TGAAAATGTGAGAATGTAAAAGG - Intergenic
928249640 2:29664157-29664179 TGTAGATGTGAGATTTTAGTGGG - Intronic
928269509 2:29843496-29843518 TGTAAATGTGATCATATGGATGG + Intronic
928557168 2:32439074-32439096 TGTATATGTGCACATATATATGG + Intronic
928776386 2:34769072-34769094 TGAAGATGGGAGAATAGAGATGG - Intergenic
928858823 2:35831301-35831323 TTTAGATTTGAGAATTTAGAGGG + Intergenic
929346286 2:40888345-40888367 TGTATAGGTGAGAGGATAGATGG + Intergenic
929898139 2:45979159-45979181 TGCATATATGGGAATATATATGG + Intronic
930056441 2:47255983-47256005 TATATATGGGATAATATATATGG + Intergenic
931973862 2:67621225-67621247 TTTATATGAAAGAATATATATGG + Intergenic
932981575 2:76675139-76675161 TGTATATTGGTGAATATAAAGGG - Intergenic
933021566 2:77200389-77200411 TATATATGTGTGCATATATATGG + Intronic
933289010 2:80415877-80415899 TTTATATGTGACAACATGGATGG + Intronic
933513580 2:83272519-83272541 TGTATATGTGTATATATATATGG + Intergenic
935870745 2:107446441-107446463 TTTATATGAGAGAAGATAAAAGG - Intergenic
936497093 2:113031890-113031912 TGCATATTTGAGAATAAGGATGG + Intronic
936579132 2:113681358-113681380 TATAGATGTGAGATGATAGAAGG - Intergenic
937561858 2:123235254-123235276 TATATATGTGTGTATATATATGG + Intergenic
937719380 2:125075916-125075938 TGAATATGTGAGAATTTGCAAGG - Intergenic
937785680 2:125894904-125894926 TATATATATGGGAATATATATGG - Intergenic
937785692 2:125894990-125895012 TATATATATGGGAATATATATGG - Intergenic
937785700 2:125895044-125895066 TATATATATGGGAATATATATGG - Intergenic
937785704 2:125895072-125895094 TATATATGTGAATATATATATGG - Intergenic
938871833 2:135485988-135486010 TGTGTATTTGTGAATATACATGG - Intronic
939041347 2:137192489-137192511 TGTATACTTGAGAAGAGAGATGG + Intronic
939396443 2:141636900-141636922 TATATATGTAAATATATAGAAGG + Intronic
939767096 2:146264304-146264326 TGTATTTGTGAGACTATCCAGGG + Intergenic
939904199 2:147890506-147890528 TGAATGTGAGAAAATATAGAGGG + Intronic
940307101 2:152238302-152238324 CGTATATATGAAAATATTGAGGG - Intergenic
940710052 2:157151631-157151653 TGTGTATGTGTGTATATAGATGG - Intergenic
941139108 2:161755553-161755575 TGAGTATGTGAGAAAAGAGAGGG - Intronic
942855517 2:180541926-180541948 TTTATATGTGCGCATATTGAGGG - Intergenic
943289976 2:186057168-186057190 TATATATGTGTGCATATACATGG + Intergenic
943298822 2:186172430-186172452 TGTGTCTCTGACAATATAGAGGG + Intergenic
943801008 2:192057412-192057434 TGTCAATGTTAGGATATAGAGGG - Intronic
943901985 2:193451394-193451416 TGTCTATGTGTGTAGATAGATGG + Intergenic
945237544 2:207645521-207645543 TATATATATGAGAACATATATGG + Intergenic
946593854 2:221283729-221283751 TGTATATTTTAGCATATATAAGG - Intergenic
946614141 2:221491204-221491226 TGTATAACTGAGAATTTATAAGG - Intronic
946996051 2:225392868-225392890 TGTATATTTGAGACTATTCATGG - Intergenic
947383603 2:229568952-229568974 TGTATATGTGTGCTTATGGATGG + Intronic
947510012 2:230743846-230743868 TGTATGTGTGTGTATATATATGG + Intronic
1169684501 20:8255922-8255944 TGTATATGTAAACATATAAAAGG - Intronic
1169855476 20:10097373-10097395 TTTATAAGTGAGAACATATAAGG + Intergenic
1170293406 20:14796689-14796711 TATGTATGTGAGAATATGAAGGG - Intronic
1170344894 20:15374264-15374286 TATATATGTGATTATATATAAGG - Intronic
1170657192 20:18298834-18298856 TGCATATGGGGGAATGTAGAAGG + Intronic
1173541543 20:43855876-43855898 TATATATGTCAGAGTATAGAGGG + Intergenic
1174581779 20:51577359-51577381 TATATATGTGAGAAGCTATATGG - Intergenic
1174991589 20:55516475-55516497 TTTATATGTGTGTATATATACGG + Intergenic
1177115330 21:17078618-17078640 TTTATAGGTGAGAAATTAGAGGG - Intergenic
1177448848 21:21238479-21238501 TGTATATGTAATAATATATTTGG - Intronic
1178880303 21:36444551-36444573 TTTATATGAGAAAATAAAGAGGG - Intergenic
1179630620 21:42676009-42676031 TGTTTATGTGTGAAGGTAGAAGG + Intronic
1180492098 22:15858804-15858826 TGTATTTCTGAGATTTTAGATGG + Intergenic
1181396079 22:22623349-22623371 TGTATATGTGTGTATATATATGG - Intergenic
1181704260 22:24639256-24639278 TGTATATGTGTGTATATATATGG - Intergenic
1182061383 22:27400663-27400685 TGTATATGTCAGAATAAACTGGG - Intergenic
1182637383 22:31739228-31739250 TGTAAATGAGAAAATAAAGATGG + Intronic
1185056447 22:48581174-48581196 TGTAAAAGTTAGAATATAAAAGG + Intronic
949195848 3:1306442-1306464 TGTTTATGTGAGAGTGTAGTGGG - Intronic
949226668 3:1703086-1703108 TGTATTTGAGATAATATGGAGGG - Intergenic
949506197 3:4730286-4730308 TGTGTATGTGTGTATAGAGAAGG + Intronic
949732585 3:7131075-7131097 TGAATATATGAGAATAGAAAAGG - Intronic
950996889 3:17509864-17509886 TATATAAGTGAGAATTGAGAGGG - Intronic
951758179 3:26115672-26115694 TGTCTATGTGAGCATATTCAAGG + Intergenic
952345421 3:32479638-32479660 TGCACATGTGAGAATTTACATGG - Intronic
953268316 3:41414889-41414911 TTTAAATGTGGGAATTTAGAAGG + Intronic
953938696 3:47070904-47070926 TGTATATGTGTGTATAGCGATGG + Intronic
955336705 3:58092772-58092794 TTTAGCTGTGAGACTATAGAAGG - Intronic
955457845 3:59143855-59143877 TGTATATGTGTAAGTATAAATGG + Intergenic
955870722 3:63435729-63435751 TGTATATGTGAGAATATAGATGG - Intronic
956282000 3:67567653-67567675 TGTATAAGTGGGAATAAAGAAGG - Intronic
956580066 3:70800874-70800896 TGAATGTGTGAAAATATGGAAGG + Intergenic
956608690 3:71099781-71099803 TGTATATGTCAGAATATGTTGGG - Intronic
956695994 3:71919923-71919945 TTTAGAGATGAGAATATAGAGGG - Intergenic
957298193 3:78358935-78358957 TGTATATGTGTGTATGTATAAGG - Intergenic
957929405 3:86859550-86859572 TATATATATGGGAATATATATGG - Intergenic
957929407 3:86859562-86859584 TGTATATGGGAATATATATATGG - Intergenic
957929459 3:86860079-86860101 TATATATATGGGAATATATATGG - Intergenic
957929463 3:86860109-86860131 TATATATATGGGAATATATATGG - Intergenic
957973590 3:87414535-87414557 TGTATATGTAGGTATATAGCTGG - Intergenic
958452365 3:94289671-94289693 CTTATAAGTGAGAATATATATGG + Intergenic
958706041 3:97656803-97656825 TGAATATATGAAAATATTGATGG - Intronic
958863442 3:99471790-99471812 TTTCTATCTAAGAATATAGAGGG - Intergenic
959974824 3:112446927-112446949 TGTGTGTGTGAGATTATAGGTGG - Intergenic
960102836 3:113762901-113762923 TGTATTTCTGAGAATATATTTGG - Intronic
960385438 3:117017089-117017111 TGTATGTGGGAGAATGTAGATGG - Intronic
960639390 3:119811763-119811785 TTTCTATGTGAGAATGAAGATGG - Intronic
963178029 3:142322338-142322360 TGAATAGCTGAGAATATAGGTGG + Intronic
964171400 3:153774881-153774903 TATATATGTGTGTATATATATGG + Intergenic
964254470 3:154760601-154760623 TGTATATGTGTGGATATTGCTGG + Intergenic
964647011 3:158969214-158969236 TGTATGTGGCAGAATACAGAAGG - Intronic
964716021 3:159722606-159722628 TGTATGTGTGTGTATAGAGAGGG + Intronic
964804830 3:160597541-160597563 TGTATATGTGACATTACAAAAGG - Intergenic
965996485 3:174889145-174889167 TGTATATGTTAGAAGACTGAGGG - Intronic
966006378 3:175018274-175018296 TGTATATTTGAGATTTTAGTCGG + Intronic
966315701 3:178643387-178643409 TGTATGTGTGTGTATATATAGGG - Intronic
968499889 4:944604-944626 TGTATAATTAAGAAGATAGATGG + Intronic
969761547 4:9188037-9188059 TGGACATGTGAGAATGTGGATGG + Intergenic
970224845 4:13846958-13846980 TGGAGATGTGAGAAGGTAGAGGG - Intergenic
970653597 4:18205232-18205254 TGTATACGTGAAAATATACAGGG - Intergenic
970930058 4:21499665-21499687 TATATATTTTAGTATATAGAAGG + Intronic
970963084 4:21896368-21896390 AGTATATGTAAAAATATAGCTGG + Intronic
971411352 4:26375912-26375934 AGTATATGTATGAATATAAATGG - Intronic
972940582 4:44190450-44190472 TGTGTGTCTGAGAATATAGGTGG + Intronic
974314099 4:60255318-60255340 TTTATTTCTGAGAAAATAGAAGG - Intergenic
974569014 4:63619591-63619613 ATTCAATGTGAGAATATAGATGG + Intergenic
974747378 4:66093078-66093100 TATATATGTGTGTATATATATGG + Intergenic
974767384 4:66364756-66364778 CGTATATGTAAGAAAATAAACGG + Intergenic
975464193 4:74690995-74691017 TGTAGATATGTGAATATACATGG - Intergenic
975980341 4:80150843-80150865 TGTGTATGTATGTATATAGAAGG - Intergenic
976378193 4:84368805-84368827 TTTATATATGAGAAAATCGAGGG - Intergenic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
976881466 4:89931213-89931235 TGTAAATATGAAAATTTAGATGG - Intronic
977518561 4:98052621-98052643 TATAAATGTGAAAATATAAAAGG + Intronic
979003835 4:115262527-115262549 TTTAAATGTGAACATATAGATGG + Intergenic
979031932 4:115659567-115659589 TATATAAGTAAAAATATAGAAGG - Intergenic
979236899 4:118410621-118410643 TTTATATGTAGGAATGTAGATGG - Intergenic
979684107 4:123492527-123492549 TGTGTGTGTGTGAATGTAGAAGG - Intergenic
980577794 4:134708023-134708045 TGTATATTTGATAATACAAAGGG - Intergenic
980741350 4:136953640-136953662 TATTTATGTAAGTATATAGATGG + Intergenic
981101870 4:140837930-140837952 TCTCTAAGTGAGAATCTAGAAGG + Intergenic
981978915 4:150768133-150768155 AGTAAATCTGAGAATAAAGAGGG + Intronic
983356478 4:166665598-166665620 TGTATATATACGAATATATATGG + Intergenic
984245448 4:177269737-177269759 AGTATATTTAAGAATAAAGATGG + Intergenic
985963454 5:3321344-3321366 TGTACATGTGATCATATAGATGG - Intergenic
986900818 5:12431330-12431352 TTTAGATGTGAAAAGATAGACGG + Intergenic
987901411 5:24017236-24017258 AGTTTATGTGAGGACATAGAGGG - Intronic
988335050 5:29896708-29896730 TTTGTATGTAAGAATATAGTAGG + Intergenic
988526296 5:31989978-31990000 TTTATAGGTGAGAAAACAGAAGG - Intronic
989695686 5:44197772-44197794 TTTAAATGTGAAAATATTGATGG + Intergenic
990009996 5:50985891-50985913 TGTATAAGAGAGAAGATAGTGGG - Intergenic
990010960 5:50996838-50996860 TGAATAAGAGAGAATATAGGAGG - Intergenic
990057062 5:51595429-51595451 TATATATTTGAAAATAAAGATGG + Intergenic
990551878 5:56889717-56889739 TTTACATGTGAGAAAATGGAGGG - Intronic
990858130 5:60294842-60294864 TTTATATGGGAGAGTAAAGAAGG - Intronic
991145056 5:63291830-63291852 TTTATATGTGAAAATAAATAAGG - Intergenic
991166790 5:63572331-63572353 TGTCTTTTTGAGAATATAAATGG - Intergenic
991895130 5:71387933-71387955 TGTATATGTGTAAAATTAGATGG + Intergenic
991993417 5:72363779-72363801 TGTATATTTGAAAAAATAAATGG - Intergenic
992302249 5:75394914-75394936 TATATATGAGAGAAGATAAATGG + Intronic
993055860 5:82978728-82978750 TGTATATTTGAGAATACACAGGG + Intergenic
993209850 5:84934132-84934154 TGTATATAAGAGAATATATAGGG - Intergenic
993574050 5:89579558-89579580 TGAACATGAGAGAATATAAAGGG - Intergenic
994343369 5:98658323-98658345 TCTATATGTGAGGAAATTGAGGG - Intergenic
994938415 5:106286981-106287003 AGCATATGTGACAATATTGATGG + Intergenic
995205430 5:109474527-109474549 AGTTTATTTGAGAATATACATGG - Intergenic
995390363 5:111634135-111634157 TGTTTATGTGAGAGCATAGGTGG - Intergenic
995577494 5:113556012-113556034 TCTTTATGTTAGAATATAAAAGG - Intronic
996250558 5:121325734-121325756 TATAAATGTAAGAATGTAGAGGG + Intergenic
996651280 5:125879917-125879939 TTCATGTGTGGGAATATAGAGGG - Intergenic
996950836 5:129123755-129123777 AGCATATCTGAGATTATAGATGG - Intergenic
998613800 5:143717996-143718018 TGTATATCTGAGTATATGCATGG + Intergenic
998710530 5:144820036-144820058 TGTATCTGTGTGAATATAGCAGG + Intergenic
999544475 5:152611993-152612015 TTTGTATATGAGAATATATAAGG + Intergenic
999553243 5:152713540-152713562 TGTATATATGTGTGTATAGATGG + Intergenic
999598796 5:153236843-153236865 GGTATATATCAGAATATAGATGG + Intergenic
1000681079 5:164185514-164185536 TGTATATATGTGAAAAAAGAAGG + Intergenic
1002546304 5:179947761-179947783 TGTATATGTAAGTATATAGTAGG + Intronic
1002722306 5:181269927-181269949 CGTATATGTGTGTATATATATGG - Intergenic
1004496210 6:16165689-16165711 TGTTTAAGTGAGAGAATAGAGGG - Intergenic
1004648616 6:17587154-17587176 TGTGTATGTGTGTATATATATGG - Intergenic
1004842145 6:19599303-19599325 TGTATAGGAGAGAGTATAGGAGG + Intergenic
1005206664 6:23412753-23412775 AGCATATGTGAGAAAATATATGG - Intergenic
1005536355 6:26759912-26759934 TGTCTATGTGAAAACTTAGAGGG + Intergenic
1006215535 6:32439106-32439128 TGAATATGAGAGAGTATAGTGGG - Intergenic
1006559360 6:34896556-34896578 TTTATATGTAAAAATCTAGAAGG + Intronic
1007231409 6:40349841-40349863 GGCAGATGTGAGAATGTAGAAGG - Intergenic
1007495071 6:42254401-42254423 TGTTTTTGTGAGATTAGAGATGG - Intronic
1008866118 6:56212137-56212159 TGTATATGTAATACAATAGAGGG + Intronic
1009007254 6:57802311-57802333 TGTCTATGTGAAAACTTAGAGGG + Intergenic
1009301787 6:62032518-62032540 TGTATATATATGAATATATATGG - Intronic
1009374930 6:62955547-62955569 TGTATATATGTGTATATATATGG + Intergenic
1009504719 6:64462457-64462479 TGGATATGTCAGCACATAGATGG + Intronic
1009569243 6:65360957-65360979 TTTATATGTAGAAATATAGATGG - Intronic
1009762852 6:68030260-68030282 TGTATATGAGAAAATAGAAATGG - Intergenic
1010538126 6:77056013-77056035 TGTAAATATGAAAAGATAGATGG - Intergenic
1010623347 6:78104203-78104225 TGTATAAGTCAGAGGATAGAGGG + Intergenic
1011064133 6:83306194-83306216 ATTATATGTGGGACTATAGATGG + Intronic
1011914073 6:92480277-92480299 TGTATGGGTGTGAATATACATGG - Intergenic
1012099975 6:95070954-95070976 TATATATGTGAATATATATATGG - Intergenic
1012993127 6:105946572-105946594 GTTATATGTGAGGATTTAGAGGG - Intergenic
1013959207 6:115878038-115878060 TTTATATGTGAACATATAAATGG + Intergenic
1014451030 6:121582005-121582027 TGTATGTGTGTGTATGTAGAAGG + Intergenic
1015048009 6:128802073-128802095 TATATATGTGTGTATATATATGG + Intergenic
1015737914 6:136420883-136420905 TGAATCAGTGAGAATAAAGATGG - Intronic
1015906693 6:138124256-138124278 TGTCTTTGTGGGAACATAGACGG - Intergenic
1016115239 6:140273858-140273880 TGTGTATGTGTCAATCTAGAAGG + Intergenic
1016288864 6:142506258-142506280 TGCAAATGTGAGAAAATATAGGG - Intergenic
1016615093 6:146038579-146038601 TGGAGATGTGAAAATAAAGAGGG + Intronic
1017447385 6:154519038-154519060 GGTATATGTGTGTATATATATGG + Intergenic
1017824074 6:158068877-158068899 TGCATGTGTGAGCATAGAGAAGG - Intronic
1018292787 6:162310103-162310125 AGTCTGTATGAGAATATAGACGG + Intronic
1019524612 7:1475207-1475229 TGTATTTTTGAAAATAGAGAGGG - Intronic
1020509609 7:9037123-9037145 TAGATATGTAAGAAGATAGAAGG - Intergenic
1020748567 7:12111011-12111033 TGCAAATGTGACCATATAGAAGG - Intergenic
1022680430 7:32540257-32540279 TGAATATGTGAGAGTATCTATGG + Intronic
1022750658 7:33220772-33220794 TGTAAATGTGAGAATTAAAAAGG - Intronic
1023484314 7:40668107-40668129 TGCATTTGTCAGAATATAAATGG + Intronic
1023519417 7:41035506-41035528 GGTAAAGGTGAGAGTATAGAGGG - Intergenic
1024352857 7:48384808-48384830 TGTGTATGTGGGTATATATATGG + Intronic
1024711721 7:52022673-52022695 TGTCTACGTGTGAATATATATGG + Intergenic
1026636544 7:72087678-72087700 TATATGTATGAGAATATAAAAGG + Intronic
1027504828 7:79003177-79003199 TGTATATGTGTGTATGTAGCAGG + Intronic
1027709340 7:81578910-81578932 TGTACAGGTGAGAATAGTGATGG - Intergenic
1027958160 7:84909367-84909389 TATTTATGTGATAATATAAAGGG - Intergenic
1027998273 7:85455370-85455392 TGTATATGTTTTAATATATATGG - Intergenic
1028340288 7:89710512-89710534 TATTTATGTGTGCATATAGAAGG + Intergenic
1029043615 7:97603686-97603708 TGTTTATGTAAGAATATAGTTGG + Intergenic
1030054740 7:105574087-105574109 TGTGTATGTGTGTATATATATGG - Intronic
1030227147 7:107166204-107166226 TGTATATGTGTGTATAGATATGG + Intergenic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1031250571 7:119375112-119375134 TGAATATATGAGAGTATACATGG + Intergenic
1031502802 7:122541619-122541641 TGAATATATGAAAATATATATGG - Intronic
1032553522 7:132807581-132807603 TGTGTATGTTAGCATATACATGG - Intronic
1032665782 7:134034953-134034975 TGTAGCTGAGAGAAAATAGAAGG + Intronic
1032902793 7:136329877-136329899 TATATAGATGAGAATATAAATGG + Intergenic
1034588373 7:152116720-152116742 TGCAGATGTGAGAATTTAGCTGG + Intronic
1034812158 7:154142211-154142233 TTTAAATGCGAGAATATAAATGG + Intronic
1034826318 7:154267614-154267636 TGTATATGTGTGTATATGTAAGG - Intronic
1035969955 8:4236975-4236997 TGTGTGTGTGAGAAAATAGTTGG - Intronic
1037051107 8:14375375-14375397 AATATATGTGAGAATAAAGAAGG + Intronic
1037071168 8:14650823-14650845 TGTTTATGTGGTAAAATAGAGGG + Intronic
1038084959 8:24185869-24185891 TGTATATCTGAGAAGAATGAGGG - Intergenic
1038388268 8:27169975-27169997 TTTAAATATGAGAATATGGAAGG - Intergenic
1039087363 8:33793216-33793238 TGTATATGTGAAAAAGGAGAAGG + Intergenic
1039157092 8:34573042-34573064 TATATATGTGTGTATATATATGG + Intergenic
1039593406 8:38769522-38769544 TGTATATGTGAGACTGTGTATGG + Intronic
1040088409 8:43369367-43369389 TGTATTTGTGTGAATCTAAAAGG + Intergenic
1040590193 8:48785045-48785067 TGTATGTGTGTTATTATAGATGG - Intergenic
1040678746 8:49783792-49783814 TGTGTCAGTGAGAATATAGTTGG - Intergenic
1041300002 8:56401732-56401754 TGTATATGTGAGTGTATACAGGG - Intergenic
1041372935 8:57182853-57182875 TGTAAATTTGGGAATAGAGATGG + Intergenic
1042046992 8:64664292-64664314 TGTATGTGTGTAAATATATATGG - Intronic
1042102804 8:65292259-65292281 TGTATATATAAGAATATTCATGG + Intergenic
1042353072 8:67797718-67797740 TATATATGGGAGTATATACATGG - Intergenic
1042447320 8:68900972-68900994 TGTTTATGTCAGATTACAGATGG + Intergenic
1044651119 8:94497026-94497048 AGTGTATGTGACAATATGGATGG - Intronic
1044656706 8:94555857-94555879 TATATATATGGGAATATATATGG - Intergenic
1045225461 8:100239963-100239985 TGGAAATGTGAGACTATAAATGG - Intronic
1045353343 8:101362413-101362435 TGTATGTGTGAGTGTATCGAGGG - Intergenic
1045353369 8:101362606-101362628 TGTATGTGTGAGTGTATCGAGGG - Intergenic
1045580827 8:103478030-103478052 TGAAGATGAGAGAATTTAGAGGG + Intergenic
1045725617 8:105169818-105169840 TGTGTGTGTGAGAATAGAGAGGG + Intronic
1046181888 8:110660396-110660418 GGTATATATGAGCATAAAGATGG + Intergenic
1046291392 8:112166471-112166493 TGTATATGTCAGGATGTGGAAGG - Intergenic
1046898452 8:119498457-119498479 TATATATGGGAAAATATATATGG + Intergenic
1046898479 8:119498656-119498678 TATATATATGGGAATATATATGG + Intergenic
1046898483 8:119498682-119498704 TATATATATGGGAATATATATGG + Intergenic
1046898538 8:119499142-119499164 TGTATATGGGAATATATATAGGG + Intergenic
1046898544 8:119499183-119499205 TGTATATGGGAATATATATAGGG + Intergenic
1047095064 8:121616141-121616163 TGTATATGTGAAAATATGTGAGG - Intronic
1048346400 8:133578565-133578587 TGTACTTATGCGAATATAGATGG + Intergenic
1048372165 8:133788432-133788454 TGTGTAGCTGAGAAGATAGAGGG + Intergenic
1050028677 9:1362633-1362655 TGTATCTGTGAGAAGAGAGCAGG - Intergenic
1050142851 9:2534440-2534462 GGCATATGTGAAACTATAGAGGG - Intergenic
1051089805 9:13393058-13393080 TGTCTTTGTGGGAACATAGACGG + Intergenic
1051215249 9:14790815-14790837 TGGATATGTGAAAATGCAGATGG - Intronic
1052483927 9:29070883-29070905 TGTATATATATGAATATATATGG + Intergenic
1052531032 9:29684107-29684129 TGTAAATGTTAGACTATACAGGG + Intergenic
1055279172 9:74654863-74654885 TATACATGTGAGAATATAGAAGG + Intronic
1056188475 9:84160968-84160990 AGAATATGTGAGAGTATTGAGGG + Intergenic
1057237807 9:93379307-93379329 TGTATTTGTGAAATTATAAAAGG - Intergenic
1057602494 9:96470972-96470994 TGTATTTGTGTGACTAGAGAGGG + Intronic
1058087382 9:100763219-100763241 TGTTTTTGTGAGAACACAGATGG - Intergenic
1058159392 9:101551236-101551258 CGTGTATGTGAGAAAATAGTGGG + Intronic
1059989927 9:119855268-119855290 TGTCTATTTGAGAAGAGAGACGG - Intergenic
1059998617 9:119938152-119938174 TGTATATGTGTGTATAGAGAAGG + Intergenic
1187001192 X:15180469-15180491 TGTATGTATGTGTATATAGATGG - Intergenic
1187668852 X:21648135-21648157 TGTTTATATGCAAATATAGAGGG - Intronic
1188384903 X:29544433-29544455 TGTATCTGTGTGCATATAAATGG + Intronic
1188471140 X:30540824-30540846 CGTATTTGTGACAACATAGATGG + Intergenic
1189708828 X:43787740-43787762 TGTGTATCTGAGAATTTAGTAGG + Intronic
1189944090 X:46159395-46159417 TGTATATGTATGGATATGGAAGG - Intergenic
1191841299 X:65515180-65515202 TGTATATGTAAGCACATAGAGGG - Intronic
1193189582 X:78553754-78553776 TATATATGTGTGTATATATATGG + Intergenic
1193489008 X:82124360-82124382 TGTATATGTTACAATAAAGTTGG - Intergenic
1193526195 X:82592405-82592427 TATATATCTGAGAAAATACAAGG + Intergenic
1193613556 X:83660926-83660948 AGAACATGTGAAAATATAGAGGG - Intergenic
1194987373 X:100505501-100505523 TGTATGTGTGTGTATATAAAGGG - Intergenic
1195118259 X:101722023-101722045 TTTCTATGTGAAAATATGGATGG - Intergenic
1195171516 X:102273060-102273082 TGTTTATGTGAGAGTACATATGG - Intergenic
1195187344 X:102414039-102414061 TGTTTATGTGAGAGTACATATGG + Intronic
1195567150 X:106354259-106354281 TGTATTTGTGAGCATATGCATGG + Intergenic
1195686983 X:107596435-107596457 TTTATCTGTGAGAATATACTCGG - Intronic
1196340442 X:114589157-114589179 TGTAAATGTGAGGATATTAATGG + Intronic
1197080521 X:122408595-122408617 TGTATATGTGTGAATCTAGCAGG - Intergenic
1197659427 X:129154153-129154175 TGTATATGGGTGTATATATATGG - Intergenic
1198567936 X:137924326-137924348 TCGATATGTGAGTATATAGTGGG + Intergenic
1198676007 X:139131360-139131382 TGTATGGATTAGAATATAGAGGG + Intronic
1198834521 X:140788869-140788891 TGTATATATGTGTATATATATGG - Intergenic
1199392614 X:147298350-147298372 TGTATGTGTGTGTATAGAGATGG - Intergenic
1199718118 X:150521658-150521680 TGTATTTGGGAGAAGAAAGAGGG + Intergenic
1200853195 Y:7907131-7907153 TGTCTAAGCCAGAATATAGAGGG + Intergenic
1201226580 Y:11824494-11824516 TGTTTGTGTGAGAAGAGAGAGGG - Intergenic