ID: 955871995

View in Genome Browser
Species Human (GRCh38)
Location 3:63449092-63449114
Sequence CAGTATTGGGAGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955871991_955871995 -6 Left 955871991 3:63449075-63449097 CCATTCTCATTCTTGGACAGTAT 0: 1
1: 0
2: 0
3: 16
4: 219
Right 955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG 0: 1
1: 0
2: 3
3: 41
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955871995 Original CRISPR CAGTATTGGGAGAGGAAAGA AGG Intronic
900079579 1:845663-845685 GAGTATAGAAAGAGGAAAGATGG - Intergenic
900824654 1:4916683-4916705 CATAATTGGGAGAGGAACAATGG + Intergenic
902190585 1:14760185-14760207 CAGTAATGGGGGTGGGAAGAGGG - Intronic
904339303 1:29823804-29823826 CAGGCATGGGAGAGGAAGGAGGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904590535 1:31612837-31612859 CAGGAGTGGGAGAGGAAGAAGGG - Intergenic
904712853 1:32444081-32444103 TAGTGTTGGGAGACGAAAGCTGG + Intergenic
905208750 1:36358762-36358784 CAGTGTTTGGCGAGGAAAGATGG - Exonic
905346439 1:37314206-37314228 CAGTAATGGGACAGCAAAGAGGG - Intergenic
905476961 1:38235741-38235763 CTGTGTTGGGAAAAGAAAGAAGG - Intergenic
905684140 1:39896745-39896767 CAGCATTGGGAGTGGGAGGAAGG + Exonic
906740487 1:48178241-48178263 CAATTTTTTGAGAGGAAAGAAGG + Intergenic
908727498 1:67192616-67192638 AAGTCTTGGGAGAGGAAACTGGG - Intronic
909138458 1:71832111-71832133 GAGTAATGGGAAAGGAGAGAAGG + Intronic
911568285 1:99491139-99491161 GTGTGTTGGGAGAGGAAGGAGGG - Intergenic
912650893 1:111438260-111438282 CAGTTTTGGAAGAGTAAACAAGG - Intergenic
912816082 1:112829751-112829773 TAGTTTTGGGAGAGGGAAGCTGG - Intergenic
913272164 1:117105040-117105062 CAGTATTGTGACATGAAGGAAGG - Exonic
915188081 1:154124378-154124400 TAGGTTTGGGAGAGGAAAGCAGG + Intronic
916048235 1:161016799-161016821 GAGTAGAGGGAGAGGAAAGGAGG + Intronic
916704112 1:167329202-167329224 CAGTTTGGGGTGGGGAAAGAAGG - Intronic
917295048 1:173510169-173510191 CATTTTTGGAAGAGGAGAGAAGG - Intronic
918320510 1:183359718-183359740 CAGCAGTGGGAGAGGGAAAATGG + Intronic
920417679 1:205809795-205809817 CAGGCTTGGGAGAGGAGAGATGG - Intronic
920532484 1:206713917-206713939 CAGGACTGGAAAAGGAAAGATGG + Intronic
920877985 1:209855096-209855118 AAGCATTGGAAGGGGAAAGAGGG + Exonic
921098976 1:211911957-211911979 CAGCTTTGGTGGAGGAAAGAAGG - Intergenic
921338915 1:214114835-214114857 CAGTATTGGAAGAGCAAGTATGG + Intergenic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
922987198 1:229874954-229874976 CTGTAAAGGGAGAGGAAAAATGG + Intergenic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923639514 1:235739942-235739964 AAGTAGTGGGAAAGGGAAGATGG + Intronic
924265702 1:242279480-242279502 CCATATTGGGAGAGAAAAGTGGG + Intronic
924353621 1:243145957-243145979 AAGTTTTGTAAGAGGAAAGAGGG + Intronic
924368325 1:243320303-243320325 CAGTGTAGGGAGTGGAACGAAGG - Intronic
1063818738 10:9809371-9809393 CAGTATTGCTAGAGGAGATAAGG - Intergenic
1064625509 10:17257625-17257647 GAGTATGGGGAGAGGAAATAGGG + Intergenic
1065342088 10:24717116-24717138 CAGTATTGGGAGAAGAAATGAGG + Intronic
1066719145 10:38319174-38319196 CCATATTGGGAGAGAAAAGTGGG - Intergenic
1068357528 10:55928909-55928931 CAGGATTTGAAGGGGAAAGAAGG - Intergenic
1069201500 10:65623178-65623200 CAGTATGGCAAGAGGAAAAAAGG - Intergenic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1070117383 10:73541982-73542004 GAGGGATGGGAGAGGAAAGAAGG + Intronic
1070516737 10:77214890-77214912 GAGTGTAGGGAGAGGAGAGAAGG - Intronic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072735461 10:97876080-97876102 CAGGATTGGGAGGGGAAAAATGG - Intronic
1072844164 10:98810502-98810524 CAGTAATGGGAAGGGAAAGCCGG - Intronic
1073356645 10:102860229-102860251 GAGGAGTGGGAGAGGAGAGAGGG + Intronic
1074290523 10:112135118-112135140 CAGTAGTGGGAGAGTGGAGAGGG + Intergenic
1074565417 10:114573129-114573151 CAGTATGGGCAGAGGATATAGGG - Intronic
1075370099 10:121928224-121928246 CAGGATGGGGAGAGTCAAGAGGG + Intronic
1076188919 10:128469401-128469423 GCTTACTGGGAGAGGAAAGAAGG - Intergenic
1076780753 10:132723264-132723286 GAGTATTGAGAGAGGAAACTCGG + Intronic
1076882487 10:133246264-133246286 CAGTGTTGGGAGAGCCCAGAGGG - Intergenic
1077452875 11:2661522-2661544 GAGTAGTGGGTCAGGAAAGATGG - Intronic
1077913717 11:6597118-6597140 CAGAGCTGGGAGAGGAAAAAGGG - Exonic
1078064178 11:8067083-8067105 CAGTATTTGGTGAGGCCAGACGG - Intronic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078383700 11:10868310-10868332 CAATTTTGGGAGTGGAAAGTAGG - Intergenic
1078516366 11:12026128-12026150 CAACCTTGGGAGAGGCAAGAGGG - Intergenic
1078881078 11:15449312-15449334 CAGTTTTGGGAAAGGAAACCTGG - Intergenic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079356411 11:19733658-19733680 ATATATGGGGAGAGGAAAGAGGG + Intronic
1079611760 11:22441496-22441518 AAGTATTGTGAGAGTTAAGAAGG + Intergenic
1079969623 11:27020270-27020292 CTCTATTGTGAGAGGAAAGAGGG - Intergenic
1082759197 11:57109996-57110018 CACTATTGGGAGATAGAAGAGGG - Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083740633 11:64709493-64709515 CAGAGTGGGGAGAGAAAAGAAGG + Intronic
1084191407 11:67500566-67500588 CAGGAATGGGAGTGGAAAGTGGG + Intronic
1084398442 11:68929980-68930002 TAGTATGGGGAGAGGTGAGAGGG - Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085862026 11:80245576-80245598 GAGTACTGGGAAATGAAAGAAGG - Intergenic
1086142257 11:83512214-83512236 CAGGATTGGGGGAGAGAAGAGGG - Intronic
1086537902 11:87870752-87870774 TGGGATTGGAAGAGGAAAGAGGG + Intergenic
1087564614 11:99838433-99838455 TAATATAGGGAGAGGAAAAATGG + Intronic
1088119922 11:106356382-106356404 CAGTTTTTGGAGAGAAAAAATGG + Intergenic
1089044512 11:115488372-115488394 CATTATTGGGAGGGGGAGGAGGG - Intronic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1089175399 11:116545283-116545305 CAGGTAGGGGAGAGGAAAGATGG + Intergenic
1089178510 11:116565023-116565045 GAGTATTGGTAAAGGAGAGAGGG - Intergenic
1089398154 11:118149268-118149290 CAGGATGCGGGGAGGAAAGAGGG + Intronic
1090360770 11:126171259-126171281 AGGTATTGAGAGAGGAAAGGGGG - Intergenic
1090835563 11:130450920-130450942 GAGTATTGGGATTAGAAAGATGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091011402 11:132004158-132004180 GGGCATTGGGAGAGTAAAGATGG + Intronic
1091209120 11:133841875-133841897 CAGTAGTGGGAGAGGAGGGCTGG - Intronic
1091439152 12:499094-499116 GAGTTTTGGGGGAGGATAGAGGG + Intronic
1092992330 12:13914911-13914933 CAGGAAGGGTAGAGGAAAGAGGG + Intronic
1093159774 12:15733060-15733082 CTGTTTTGGGAGAGGAATGCTGG - Intronic
1095232549 12:39758412-39758434 CTGTATTTGGAGAGAAAAGGTGG - Exonic
1095512129 12:42963089-42963111 CAATATTGAAAGAGCAAAGAAGG + Intergenic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096541899 12:52312701-52312723 CAGTAAGGAGAGAGGAAAGAGGG + Intergenic
1097488120 12:60231800-60231822 CAGTATAGAGAAAGGAAGGAAGG - Intergenic
1098709409 12:73736717-73736739 CAGATATGGGAGAGGAAAAATGG - Intergenic
1099307766 12:80979533-80979555 CAATACTGGGAGAAGACAGAGGG - Intronic
1100442425 12:94629205-94629227 CATTGTTGGTAGAGGACAGATGG - Intronic
1100911862 12:99373328-99373350 GATAATTGGGAGAGGAAAAAAGG + Intronic
1101091101 12:101286681-101286703 CAGTAGCTGGAGAGGAGAGATGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1104438568 12:128776555-128776577 CAGAATCGGGAGACGAAAGGGGG + Intergenic
1105707365 13:22976694-22976716 CAGTCCCGGGAGAGGAAAGGTGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106899183 13:34336880-34336902 CAGTGTCTGGAGAGAAAAGAAGG + Intergenic
1107777801 13:43864902-43864924 CAGTCTTCTGGGAGGAAAGAGGG + Intronic
1108250683 13:48564706-48564728 GAGTATTGTGAGGGGAAAAAGGG + Intergenic
1108703750 13:52966272-52966294 GAGAAATGGGAGAGAAAAGAAGG - Intergenic
1108767468 13:53649877-53649899 CAGAATTGAGAGTTGAAAGAAGG - Intergenic
1108789273 13:53947544-53947566 CAGTATTGGGAGTGAGAAAATGG - Intergenic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1109971753 13:69779439-69779461 CAGTAAAAGGAAAGGAAAGAAGG - Intronic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110446624 13:75590324-75590346 CAGGATATGGAGTGGAAAGATGG - Intronic
1111454386 13:88461378-88461400 AAGTATTGGAGGAGGACAGAGGG + Intergenic
1111813398 13:93120015-93120037 TAATATTGGGAAAGGAAAGCAGG + Intergenic
1112853319 13:103733939-103733961 CAGAGTTGGGAGGAGAAAGACGG + Intergenic
1113201820 13:107874977-107874999 AAGCATTGGGAGTGGACAGAGGG + Intergenic
1114258615 14:21022362-21022384 CAGGAGTGGGAGATGAATGAAGG + Intronic
1114497316 14:23141937-23141959 TAGCATTGGGACAGGAAATAAGG + Intronic
1114655741 14:24314691-24314713 GAGCAGTGAGAGAGGAAAGAGGG - Exonic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116225661 14:42148757-42148779 AAGTATTGGGAGCAGAGAGATGG - Intergenic
1119373676 14:74170016-74170038 CAGTACTGGAATACGAAAGAGGG + Intronic
1119447172 14:74675401-74675423 AAATTTTGGCAGAGGAAAGAAGG - Intronic
1119889683 14:78173550-78173572 CAGAATTGGGGGAGGATGGAGGG - Intergenic
1119892687 14:78194727-78194749 CAGTAGTTGCAGAGGAGAGAAGG + Intergenic
1120111085 14:80557752-80557774 GAGTATGAAGAGAGGAAAGATGG - Intronic
1120771361 14:88383908-88383930 CTGGATTTGGAAAGGAAAGAAGG + Intergenic
1125415009 15:39443268-39443290 AAGAATGGAGAGAGGAAAGAAGG + Intergenic
1127440708 15:59004229-59004251 GATAATTGGGAGAGAAAAGAAGG - Intronic
1127906519 15:63380234-63380256 GAGAATTGGGAGAGGAGATAAGG + Intronic
1128702052 15:69812100-69812122 GATCATTGGGAGAGGAAATACGG - Intergenic
1128775177 15:70314888-70314910 CAGGATTCAGAGAGAAAAGATGG + Intergenic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129379065 15:75154226-75154248 GAGGATTGGGAGAAGAAAGAGGG - Intergenic
1131034854 15:89215375-89215397 CATTTTTTGGAGAGGAAACATGG - Intronic
1131749983 15:95495787-95495809 GACAAATGGGAGAGGAAAGATGG - Intergenic
1131998373 15:98155243-98155265 GAGTGTCTGGAGAGGAAAGAGGG + Intergenic
1134048068 16:11116053-11116075 GACTGTTGGGAAAGGAAAGAAGG + Intronic
1134378384 16:13701132-13701154 CAGTAGAGGGAGAGGCAAAAAGG - Intergenic
1137462789 16:48680532-48680554 CAGCATTGGGAGCAGAAGGAAGG - Intergenic
1137995673 16:53208552-53208574 CAGCACTGGGAAAGGAAGGAGGG - Intronic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138399148 16:56731279-56731301 CAGTTTGGGGAGAGTAATGAAGG - Intronic
1138564254 16:57821259-57821281 AAATATTGGGAGAGCGAAGAGGG + Intronic
1139203748 16:65005412-65005434 CAGTTTAGGGAGAGGACAGATGG + Intronic
1139572266 16:67820755-67820777 CAGGACTGGGGGAGGAGAGATGG + Intronic
1140709991 16:77668739-77668761 CAGTTATGATAGAGGAAAGAGGG - Intergenic
1140751110 16:78024738-78024760 GAGGATTGGGAGAGAGAAGATGG - Intronic
1141221161 16:82070418-82070440 AAGTAATGGGGAAGGAAAGATGG - Intronic
1142956748 17:3527941-3527963 CAGTAATGGCAGAGCAGAGAGGG + Intronic
1143619451 17:8072737-8072759 CAGAATGGGGAGAGGAGAGACGG + Exonic
1143621273 17:8081377-8081399 CAGTAGAGCAAGAGGAAAGAGGG - Exonic
1143929179 17:10403209-10403231 AATTATTGGGAGAGGGGAGAGGG - Intronic
1144174717 17:12694088-12694110 TAGAACTGGGAGTGGAAAGAAGG + Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144360395 17:14486595-14486617 CAGTAATGGGAGAGGGAGAAAGG - Intergenic
1147383926 17:40070986-40071008 CAGTAGAGGGAGAGGAAGAAAGG - Intronic
1150443727 17:65212366-65212388 TGGTACTGGGATAGGAAAGATGG + Intronic
1150896733 17:69220287-69220309 CAGTATATGAAAAGGAAAGAAGG + Intronic
1151656330 17:75497912-75497934 GAGGATTGGGGGAGGAGAGAGGG + Intronic
1153881572 18:9425902-9425924 CAGTTTTGGGACAGGTAAAATGG + Intergenic
1153891133 18:9516579-9516601 CAATATTAGGAGGGGAAACAGGG - Intronic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1157320283 18:46628995-46629017 AAGTATGGGGAGATGAAATAGGG + Intronic
1157491648 18:48127804-48127826 CAGGAGTGGGAGAGGAGGGATGG + Intronic
1157496255 18:48159676-48159698 AAGTATTTGGAGAAGAAAGAGGG - Intronic
1158419642 18:57281606-57281628 CAGTGTTGGGAGAGGAGTGTTGG - Intergenic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1159503128 18:69299116-69299138 CAGCAGTGGGAGAAGAAAGCAGG - Intergenic
1159976352 18:74717342-74717364 CAGTATTTGCAGAGAAAAAAAGG - Intronic
1160158491 18:76451956-76451978 CACTATTGGGAGAGTAAGTACGG + Intronic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160737685 19:671584-671606 CAGTAGTGGGAGCAGAAAGGGGG + Intergenic
1161603649 19:5201911-5201933 GAGTATTGGGAGAGCCAAGGAGG - Intronic
1161652885 19:5496201-5496223 CAGAACTGGGAGGGGACAGATGG + Intergenic
1162771898 19:12954100-12954122 AAGTATTGGGGGAGGAACCAGGG + Exonic
1163458708 19:17423879-17423901 CAGAGTTGGGAGAGGGAAGTAGG - Intronic
1165056425 19:33179042-33179064 CAGTATTAAGAAAGCAAAGAAGG - Intronic
1165476880 19:36035768-36035790 CATTCATGGGAAAGGAAAGAAGG + Intronic
1165719576 19:38069528-38069550 CAGTCTTAGGTGAGGACAGAAGG - Intronic
1166909874 19:46146401-46146423 CAATTTTGGATGAGGAAAGATGG - Intronic
1167071389 19:47223979-47224001 CATGATTGGGAGAGGAAAAAAGG + Intronic
1167170247 19:47826156-47826178 GAGAAGTGGGAGAGGACAGAGGG + Intronic
1167449580 19:49559226-49559248 CTCTATTGGGAGAGGACAGCTGG - Intronic
1167607426 19:50488915-50488937 AAGAAATGGGAGAGGGAAGAAGG + Exonic
1167699407 19:51033737-51033759 CAGGAATGGGAGAGGCAGGAGGG + Intronic
1167935393 19:52902240-52902262 TAGTATTGGGAGACGGAAGCTGG + Intergenic
925881728 2:8358295-8358317 CAGTATAGAGAAAGGAAAGTTGG + Intergenic
926010045 2:9400288-9400310 CAGGAGTGGGGGAGGAAGGAAGG - Intronic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
929322827 2:40566125-40566147 AAGGAGTGGGAGAGGAAAGTTGG - Intronic
930792174 2:55345307-55345329 CAGTATTAGGATAAGAAGGAGGG - Intronic
931808128 2:65827711-65827733 AAATGTGGGGAGAGGAAAGAGGG + Intergenic
932267897 2:70384042-70384064 CAGTCTTTGGAGAGAATAGATGG - Intergenic
932409502 2:71537044-71537066 CTGAATTGGGAGAGGAGGGAAGG - Intronic
933946010 2:87286702-87286724 CAGTGAGGGGAGAGGAAAGCAGG + Intergenic
934019677 2:87933888-87933910 CAGAATGTGGAGAGGAATGAAGG - Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
935534644 2:104279883-104279905 CAGATTTGGAAGAGGAAAGAGGG - Intergenic
936334201 2:111574884-111574906 CAGTGAGGGGAGAGGAAAGCAGG - Intergenic
936528866 2:113261183-113261205 CAGTTTCTGGAGAGGAAACAGGG + Intronic
937293766 2:120797712-120797734 GAGTACTGGGAGGGGAGAGAGGG + Intronic
937617856 2:123947201-123947223 AAGTATAAGGAGAGAAAAGAAGG + Intergenic
938570927 2:132561245-132561267 CAGGTTTAGGAGAGAAAAGAAGG - Intronic
938873715 2:135510564-135510586 CAGGATTTGGAGTGGGAAGAAGG - Intronic
938991658 2:136635888-136635910 CAGAAATGTGGGAGGAAAGATGG - Intergenic
939071235 2:137545986-137546008 CTTTATTGGGATAGGAAAGTGGG + Intronic
939600565 2:144184553-144184575 CAGTAATGAGAGTGGAAAAATGG + Intronic
939614855 2:144350666-144350688 CAGTCCTGGGAGAGGAAGAAGGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
941165960 2:162083239-162083261 AAGTATTGGGAAATGAAAGTTGG + Intergenic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
941718429 2:168787711-168787733 CAGTTTTTGGAAAGGAAAAATGG + Intronic
941965643 2:171297722-171297744 CAGTAATGGGAGAGGAAAGGAGG + Intergenic
942339223 2:174925567-174925589 CAGCCTTTGGAGAGAAAAGATGG - Intronic
942707492 2:178793102-178793124 GACTATAGGGAGAGGACAGATGG - Intronic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943002801 2:182350288-182350310 CAGTATTGGGCTATGAGAGATGG + Intronic
943507739 2:188782962-188782984 CATGATTGGGAAAGGAAGGATGG - Intronic
945026670 2:205626065-205626087 CATTATTTAGAGAGTAAAGAGGG + Intergenic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
945332519 2:208556543-208556565 TACTATGGGGGGAGGAAAGAAGG - Intronic
945741061 2:213661906-213661928 CAGTCTTTGAGGAGGAAAGATGG - Intronic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
946989129 2:225308231-225308253 CTGGATTGGGAGAGGAACAATGG + Intergenic
947925375 2:233916881-233916903 CAGTATTGGGCCAGGCAAGAGGG - Intergenic
948250566 2:236525311-236525333 CTGGATTGGGAGAGCCAAGAGGG - Intergenic
948806381 2:240455086-240455108 CAGGATCGGGAGGGGGAAGATGG + Intronic
948881966 2:240863518-240863540 TGGGATTGGGTGAGGAAAGAGGG - Intergenic
1168862417 20:1055306-1055328 TAGGACTGGGAGAGGTAAGATGG - Intergenic
1169428262 20:5512797-5512819 CAGTATTGGGAGAGGCAGCAGGG + Intergenic
1169663293 20:8005463-8005485 AAGTGCTGGGAGGGGAAAGATGG + Intronic
1169866940 20:10211840-10211862 CAGGATGGGGAGAAGAAACAAGG + Intergenic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1170472106 20:16678237-16678259 CAGAATTGGTAGATGAGAGAAGG + Intergenic
1170810740 20:19672266-19672288 CACTATTGAGAGAGGAAATCAGG - Intronic
1171021138 20:21585054-21585076 CAGGTTTGGGTGAGGAAAGGGGG - Intergenic
1171135673 20:22692400-22692422 AAGCACTTGGAGAGGAAAGAGGG + Intergenic
1171322699 20:24260415-24260437 CAGTATGGGGAGAAGAAAGATGG - Intergenic
1172127293 20:32632229-32632251 CAGGAGTGGGAGAGGGGAGAAGG + Intergenic
1172185041 20:33026326-33026348 CAGCATGGGGTGACGAAAGAGGG + Intergenic
1172190304 20:33058221-33058243 GGGTACTGGGAGCGGAAAGAAGG + Intronic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1174707945 20:52676293-52676315 AAGTTTGGGGAGAGGCAAGAAGG - Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1176222396 20:63975829-63975851 CGGCCTGGGGAGAGGAAAGAGGG + Exonic
1177435552 21:21048066-21048088 CTGGATTTGGAAAGGAAAGAAGG - Intronic
1179580453 21:42340150-42340172 CAGTATGGGTTGAGGCAAGAAGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1181638830 22:24186498-24186520 CAGGACTGGGAGAGGCATGAAGG - Intronic
1182243879 22:28939644-28939666 CAGTACTTGCAGAGGAGAGACGG - Intronic
1183646295 22:39128923-39128945 CAGTAATGGGATGGGAAGGATGG + Intronic
1184203329 22:42984475-42984497 CAGTCTGGGGAGATGCAAGATGG - Intronic
1184990801 22:48168499-48168521 CACTAGTGGGAGAGGCAAGAGGG + Intergenic
1185102658 22:48850007-48850029 CATTACTGGGACAGGGAAGATGG + Intronic
1185110030 22:48895628-48895650 CAGACCTGGGAGAGGAGAGAGGG + Intergenic
949569119 3:5274662-5274684 CAGTCTTTGGGGAGGCAAGAGGG + Intergenic
950640974 3:14347766-14347788 CTGCATTGGGAAAGGAAAGTGGG - Intergenic
951567229 3:24023333-24023355 CAGTGATGGGAGGGGACAGACGG + Intergenic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
951983800 3:28595501-28595523 CAGTCTGAGGAAAGGAAAGAGGG + Intergenic
952677875 3:36054640-36054662 CAGGATGGGGAAAGAAAAGAGGG + Intergenic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953269223 3:41424086-41424108 CAGCACTGGCAGGGGAAAGATGG - Intronic
954485187 3:50843069-50843091 CATTATTGAGACAGGAATGATGG + Intronic
954604853 3:51901343-51901365 TAGTATTGGGAGATGGAAGCTGG - Intronic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
954784249 3:53081419-53081441 GGGGATTGGAAGAGGAAAGAAGG + Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
956530487 3:70212345-70212367 CAGTTTGGGGAGAAGAATGAGGG - Intergenic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
961780410 3:129317265-129317287 CAGTATTGGGGGTGCAGAGAAGG + Intergenic
962126344 3:132623834-132623856 CAGAATTGGCAGAGGAAACCAGG - Intronic
962694277 3:137932193-137932215 CATTATTTGGACAGGAAAGGAGG + Intergenic
962965466 3:140349584-140349606 CAGTATTGGGTGTGGTATGAGGG + Intronic
964158649 3:153618508-153618530 CTGTCTTGGGAGAGCAAAGAAGG - Intergenic
964161595 3:153652147-153652169 CATGATTTGGAGAGGCAAGAGGG - Intergenic
964240808 3:154591943-154591965 CAATATTGTTAGATGAAAGAGGG - Intergenic
964697896 3:159530451-159530473 GAGTATAGGGAAGGGAAAGAGGG - Intronic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
965870743 3:173261522-173261544 CAGCATTGGGATAGCAATGAAGG - Intergenic
966320240 3:178694362-178694384 GAGAATTGGGAGAGGACAGGAGG - Intronic
966342849 3:178944830-178944852 GAGTACTGAGAAAGGAAAGAAGG - Intergenic
966953919 3:184853567-184853589 CAATAATGGGAGAGGAGTGAAGG + Intronic
967073557 3:185982718-185982740 CAGGACTGGGAGAGGATAGTGGG - Intergenic
967589564 3:191257520-191257542 CATAACTGGGATAGGAAAGATGG + Intronic
967742115 3:193014970-193014992 CAGCTTTTGGAGAGGAGAGAAGG + Intergenic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
968243949 3:197122481-197122503 CAGTATAAAGATAGGAAAGAAGG + Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969302302 4:6304262-6304284 CAGAATGGGGAGAGGAAATGAGG - Intergenic
971115318 4:23639702-23639724 GAATATTTGGAGAGGAGAGATGG - Intergenic
971923492 4:32974876-32974898 AAGTATTGAGAGAAGAAAGGCGG - Intergenic
972580279 4:40389170-40389192 AAGAACTGGGAGAAGAAAGATGG + Intergenic
972968718 4:44545602-44545624 CAGTAGTGGGAAAGGAAGGAAGG - Intergenic
974651764 4:64763218-64763240 CAGTATTTAAAGGGGAAAGAAGG - Intergenic
975059798 4:69983820-69983842 CAGTCTTTGGAGAGAATAGATGG + Intergenic
975757282 4:77583339-77583361 CTGTGTTGGGAGATGAAGGATGG - Intronic
975973919 4:80073333-80073355 CAGATTTGGGAAAGGGAAGAAGG + Intronic
976356645 4:84126611-84126633 CAGTATTAGGAATGTAAAGAAGG + Intergenic
976431512 4:84966969-84966991 CAGGGGTGGGAGAGGAGAGAGGG - Intergenic
977027293 4:91834991-91835013 CAGTGATGGGAGAGGTAAGCTGG + Intergenic
978200194 4:106016758-106016780 CAGTACAAGGGGAGGAAAGAAGG + Intergenic
978410628 4:108420944-108420966 CAGGAATGGTAGAGGAAGGAGGG + Intergenic
979211036 4:118103392-118103414 CAGAATTGAGAGAGGAAGAAGGG + Intronic
979248179 4:118533640-118533662 AAGTTTTGTAAGAGGAAAGAGGG - Intergenic
980319343 4:131248636-131248658 AAGTATTGGGAGTGGAAAAATGG - Intergenic
980438687 4:132814091-132814113 TAGTGTTGGGAGACGAAAGCTGG + Intergenic
981337902 4:143587615-143587637 CACGGTTGGGACAGGAAAGAAGG + Intronic
981403910 4:144344524-144344546 CAGAAGTGGAAGAGGAAAAAGGG + Intergenic
981902279 4:149880693-149880715 AAGTATTGGTAGAGAAAGGAAGG + Intergenic
981994480 4:150961101-150961123 CAATATGGGGTGAGGATAGAGGG - Intronic
982558779 4:156902377-156902399 CAGGATTGTGAAAGGAAACAGGG - Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
985177374 4:187215750-187215772 GGTGATTGGGAGAGGAAAGACGG + Intergenic
985421849 4:189792373-189792395 AAATATTGGGAGATGAAAGCAGG - Intergenic
988658979 5:33243582-33243604 CAGTATGTGGAGAAGAAAGAAGG - Intergenic
989235037 5:39137303-39137325 CATTATGGGGAGAGACAAGATGG + Intronic
989261410 5:39423657-39423679 AAGTAATGGGAGTGGAAAGCAGG - Intronic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
992562340 5:77965044-77965066 CAGGTTGGGGTGAGGAAAGAAGG - Intergenic
992770582 5:80043592-80043614 CAGGACTGGGAGATGAAGGAGGG + Intronic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
994849069 5:105030177-105030199 AACTATTAGGAGAAGAAAGAAGG - Intergenic
995484679 5:112628334-112628356 CAGTGTTGGGAGGGGAGAGAAGG + Intergenic
995550193 5:113273886-113273908 CAGACTTGGGAGATGAAGGAAGG - Intronic
995760437 5:115556248-115556270 CAGGAATGGGAGAAGAAAGCAGG - Intergenic
995850209 5:116536962-116536984 GGCTATTAGGAGAGGAAAGATGG + Intronic
997033986 5:130164997-130165019 CAGTATTGGTGGAGTATAGAGGG + Intronic
997307502 5:132849839-132849861 CAGTTTTGGGTAAGGAAAGTAGG - Intergenic
997346324 5:133195117-133195139 CAGGAATGGAACAGGAAAGAGGG + Intergenic
998334102 5:141355593-141355615 CAGTTTTGGGACAGAACAGAGGG + Exonic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
999059591 5:148619064-148619086 AAGAATTGAGGGAGGAAAGAAGG + Intronic
999344021 5:150798745-150798767 AAGGATTGGGAGAGCACAGAAGG - Intergenic
999380806 5:151119692-151119714 AAGTATTGGAAGAGAACAGAAGG + Intronic
999450896 5:151677383-151677405 AGGTTTTGGGAGAAGAAAGAGGG - Intronic
999685020 5:154094904-154094926 AAGTATGGGGAGAGGAAGGAGGG + Intronic
999733194 5:154491936-154491958 CAGAATTGGGTGGGGAAGGAGGG + Intergenic
1000503131 5:162077911-162077933 GAGGATTGGGGGAGGAAAGGAGG + Intronic
1001385521 5:171335566-171335588 CAGATTTGGGAGAGGAGGGATGG + Intergenic
1002982808 6:2158682-2158704 CAGTATTGGGGCAAGAAAGTGGG + Intronic
1003145478 6:3506533-3506555 CAGAAATGAGAGAGGAGAGAAGG + Intergenic
1003426728 6:6002861-6002883 AAGTGTTGGGAGACGAAGGAGGG - Intronic
1003478388 6:6506614-6506636 AAGTATTTGGAAAGGAAAGGAGG + Intergenic
1003833063 6:10036117-10036139 CAGGATTGAGAGAGGTTAGAAGG + Intronic
1004681739 6:17902405-17902427 CAGGATTTGGAGAGAAAATAAGG + Intronic
1004819298 6:19349624-19349646 CAGTAATGAAAAAGGAAAGAAGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005252913 6:23967864-23967886 CAGAATAGGGAGTGAAAAGATGG + Intergenic
1006919379 6:37617387-37617409 CAGGATTTGGTGAGGAAGGAAGG - Intergenic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1009527722 6:64767415-64767437 GAGTATGGGGAAAGGGAAGATGG - Intronic
1009964495 6:70564524-70564546 CAGTCATGGCAGAAGAAAGACGG + Intergenic
1010044511 6:71425481-71425503 CAAAGGTGGGAGAGGAAAGAAGG + Intergenic
1010505921 6:76659203-76659225 CAATATTTGGAGAGGGAAGTGGG + Intergenic
1011216941 6:85015111-85015133 CAGAATAGGGAGACGAAAGGAGG - Intergenic
1011225997 6:85107941-85107963 CAGATTTGGGAAAGGCAAGATGG + Intergenic
1013079006 6:106796086-106796108 CCTCTTTGGGAGAGGAAAGAAGG + Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013644906 6:112127503-112127525 CAGTATGGGGAGAAGAGTGAGGG + Intronic
1013760370 6:113510960-113510982 CAGCAGGGGGTGAGGAAAGAGGG + Intergenic
1013875937 6:114828415-114828437 CTGTATTGGGAATGCAAAGAAGG - Intergenic
1014041385 6:116831010-116831032 TAGTTTTGGGAAGGGAAAGAAGG - Intergenic
1014785479 6:125613847-125613869 TAGTAGTGGTAGAGGAAAAATGG - Intergenic
1014853883 6:126375561-126375583 CAATATGTGGAGAGCAAAGACGG - Intergenic
1014908553 6:127061092-127061114 TAATATAGGGAGAGGAAAAATGG + Intergenic
1015002087 6:128230161-128230183 CAGGAAATGGAGAGGAAAGAGGG + Intronic
1015396771 6:132743213-132743235 CAGCATTGGGACATCAAAGATGG - Intergenic
1016113998 6:140260069-140260091 CAGTTTTTGGACAGGTAAGATGG + Intergenic
1016354087 6:143198937-143198959 AAAGATTGGGACAGGAAAGAAGG - Intronic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1016932396 6:149424189-149424211 CAGAGTTGGGAGAGGACAGCAGG - Intergenic
1018174442 6:161166837-161166859 CAGAAATGGGAGAGGAAAGTTGG - Intronic
1018261263 6:161973208-161973230 CAATATTGGGAAAGTAAGGAGGG + Intronic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1018840451 6:167512753-167512775 CAGTTTTGAGTGGGGAAAGATGG + Intergenic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1020052878 7:5094075-5094097 CAGTATGAGGAGCAGAAAGAGGG + Intergenic
1021853059 7:24827360-24827382 CAGCATTGGGAGAGGGAAAGAGG + Intronic
1024437517 7:49376762-49376784 CAGTATTGTAAAAGAAAAGATGG - Intergenic
1026451022 7:70529730-70529752 CAGAATTTGGAGAGGAACAATGG + Intronic
1026605218 7:71810134-71810156 CAGAATTTGGAGGAGAAAGATGG + Intronic
1028125178 7:87104628-87104650 CAGAATTGGTAGAGCAGAGAAGG + Intergenic
1028308424 7:89296760-89296782 CAGTTTAGGGAGAGGAAAGGTGG - Intronic
1028398306 7:90396757-90396779 TAGTACTGGGAGAGGGAAGGTGG - Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1030514270 7:110520444-110520466 CAGTGTTGGGAGGGGAACCAAGG - Intergenic
1031727224 7:125255594-125255616 AAGTAGTGGGAAAAGAAAGAGGG - Intergenic
1031777948 7:125924194-125924216 CAGGACTGGCAGAGGAGAGAAGG - Intergenic
1033024599 7:137760289-137760311 CAGCATTTGGGGAGGAGAGAGGG - Intronic
1033637218 7:143223125-143223147 CAGGTTTGGGAGAGAAGAGACGG - Intergenic
1033903148 7:146168018-146168040 CAGTATGGGGAGAAAAATGAAGG + Intronic
1034405439 7:150899628-150899650 CATCATGGGGAAAGGAAAGATGG - Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034691146 7:153014768-153014790 TAGGAGTGGAAGAGGAAAGAAGG - Intergenic
1035525927 8:313252-313274 GAGTATAGAAAGAGGAAAGATGG + Intergenic
1035910655 8:3562165-3562187 CAGTAGTAGGTGGGGAAAGATGG + Intronic
1035916122 8:3625426-3625448 ATGTAGTGGGAGAGGAAAGAGGG - Intronic
1036756318 8:11473583-11473605 CAGGATGGGGATGGGAAAGAAGG - Intronic
1037992349 8:23329962-23329984 CAGTATGGGGAGAAGAAAAAAGG + Intronic
1039547619 8:38421191-38421213 CCCTCTTGGGAGAGGAGAGACGG + Intronic
1039597806 8:38806529-38806551 CTGTCTTGGGAGGAGAAAGAGGG + Intronic
1039733805 8:40308166-40308188 CAATATTTGGAGAGGACAGAAGG + Intergenic
1041701222 8:60791216-60791238 CAGGTTTAGGAGAGGAATGAGGG + Intronic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1042782688 8:72509635-72509657 CAGTATTGCCTCAGGAAAGAAGG + Intergenic
1043283266 8:78496397-78496419 CAGTATTTGGAGAGGAGGGAAGG + Intergenic
1046321776 8:112587665-112587687 GAGTATTAGGAGAAAAAAGAAGG - Intronic
1046934870 8:119875866-119875888 CAGTTTTGGGACAGGTAAAATGG + Intronic
1048549626 8:135422273-135422295 CAGTGTTGGAAGAGCAAAGTGGG - Intergenic
1048793529 8:138127503-138127525 CAGAATTGGAAGAGGAAAAATGG - Intergenic
1048927218 8:139281873-139281895 CAGGAGTGGGGCAGGAAAGAGGG - Intergenic
1049224530 8:141443515-141443537 AGGTAATGGGAGAGGGAAGAGGG - Intergenic
1049505766 8:142996651-142996673 TAGTACTGGGAGGGGGAAGAGGG - Intergenic
1050944857 9:11503981-11504003 CATTATTGGGGGATGAAATAGGG - Intergenic
1052316935 9:27125003-27125025 CAGTTATGAGAGAGGAAAAAGGG - Intronic
1052508146 9:29381241-29381263 TAGTATTGGGAGATGGAAGCTGG - Intergenic
1056282773 9:85058148-85058170 AAGGAGGGGGAGAGGAAAGAAGG + Intergenic
1057247308 9:93467546-93467568 GAGACTTGGGATAGGAAAGATGG + Intronic
1057403885 9:94750227-94750249 CAGTAGCTGGAGAGAAAAGAAGG - Intronic
1058501845 9:105627270-105627292 CACTATTAAGAGAGTAAAGAAGG - Intronic
1058594047 9:106595832-106595854 AGATATGGGGAGAGGAAAGAAGG + Intergenic
1059242465 9:112818833-112818855 CAGTACTGTGATAGGAACGATGG + Intronic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1059827971 9:118053845-118053867 CAGTATTGGAAAAGGAGAGTGGG - Intergenic
1060183188 9:121547817-121547839 GAGTATTTGGGGAGGAAAGCAGG - Intergenic
1061978424 9:134085568-134085590 CAGTATTAGGGGAGGAGAGAAGG - Intergenic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187189843 X:17023723-17023745 CAGCATTTGGAGAGGAATGAGGG + Intronic
1187256500 X:17647840-17647862 CAGGATTGGAGGAGGAAAGGTGG + Intronic
1188026566 X:25216342-25216364 CAAGATTGGGAGGGGAAAGGGGG - Intergenic
1188168330 X:26890658-26890680 CAGTATAGGGAAAGGAAACAAGG + Intergenic
1188200817 X:27291764-27291786 CAGTTTTTGGACAGGTAAGATGG + Intergenic
1188369877 X:29356652-29356674 CCATATTGGGAGAGGGAATAGGG - Intronic
1190026467 X:46928210-46928232 CAGGATTGGCAGGGCAAAGAGGG - Intronic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1192639453 X:72848099-72848121 AAGGATTGGGGGAGGCAAGATGG + Intronic
1192642258 X:72872706-72872728 AAGGATTGGGGGAGGCAAGATGG - Intronic
1193150415 X:78118742-78118764 CAGAATTCAGAGAGGAAAGTTGG + Intronic
1193202592 X:78709450-78709472 AAGCATTGGGAGAGGAATAAAGG - Intergenic
1194056014 X:89132763-89132785 AAGTATAGGAAAAGGAAAGAAGG - Intergenic
1194966440 X:100293748-100293770 AAGTATTTGGATAGGGAAGAAGG + Exonic
1194972945 X:100364189-100364211 CAGTATTTGGATAGGAAAACAGG + Intronic
1195691610 X:107630409-107630431 CTATATTGGGAGAGGAGAGGGGG + Intronic
1196284533 X:113863922-113863944 CAGCACTGGCAGGGGAAAGATGG + Intergenic
1197658359 X:129142675-129142697 CAGTAATGGAAGAGGAATGAAGG + Intergenic
1197816913 X:130507206-130507228 AAGTATGGAGAAAGGAAAGAAGG - Intergenic
1199124850 X:144105247-144105269 CAGAATGTGGAGAGGAATGAAGG + Intergenic
1200250701 X:154552363-154552385 CAGTACTGGGAAGGGAAAGGAGG + Intronic