ID: 955877872

View in Genome Browser
Species Human (GRCh38)
Location 3:63512639-63512661
Sequence CTGAATTCAAAGCTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 471}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955877872 Original CRISPR CTGAATTCAAAGCTGGAGGA AGG Intronic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901894911 1:12303182-12303204 CTGAAATCAAAGCTTGGAGACGG + Intronic
902540977 1:17154504-17154526 CTGACTTGGAGGCTGGAGGAAGG - Intergenic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
907728032 1:57038606-57038628 CTGAATTGGAAGCTGGAAGAAGG - Intronic
907864407 1:58385692-58385714 CAGGATGCAAAGCAGGAGGAAGG + Intronic
908434827 1:64094891-64094913 ATAAATTCAAAGCTTCAGGAAGG - Intronic
910037445 1:82805133-82805155 TTGAATACAAGGCTGGATGAGGG - Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
912484541 1:110015016-110015038 CTGAATGGAAAGGTGGGGGAAGG + Intronic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
916084917 1:161261464-161261486 CTGCATTCACAGCTGCAGGCGGG + Intronic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
918742664 1:188154759-188154781 TTGAATTTAAAACTGGAGAAGGG - Intergenic
919002729 1:191854217-191854239 CTGCATACAAAATTGGAGGACGG - Intergenic
919229583 1:194756490-194756512 CTGAATTCTAAGCTGGTTAATGG + Intergenic
920628989 1:207633146-207633168 TTGAATTCAGAGCTGGAGCTGGG - Intronic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
923273053 1:232374565-232374587 GAGAATGGAAAGCTGGAGGAAGG - Intergenic
1063306383 10:4905492-4905514 CTAAATTCAAAGCTAGGAGATGG - Intergenic
1063756097 10:9010450-9010472 CTGATTTCAAAGGTGGGGGATGG - Intergenic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065144353 10:22753298-22753320 CTGGATTCAGAACAGGAGGAAGG + Intergenic
1065153448 10:22846167-22846189 GTGCATTCAAAGTTGGTGGAAGG - Intergenic
1065694955 10:28371204-28371226 CTGACTTTGAAACTGGAGGAAGG - Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067966518 10:50919323-50919345 CTCAATTCAAATCTGAAGAAGGG - Intergenic
1068557697 10:58477404-58477426 CTGAACTCCAAGCAGCAGGAGGG + Intergenic
1068685598 10:59867349-59867371 CTGAATTCAAAAAGGGAGGGAGG - Intronic
1070430813 10:76335891-76335913 CTGAATTCCAACAGGGAGGAGGG + Intronic
1070452562 10:76576622-76576644 CTGAATGCAGAGCTCTAGGAAGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1074232822 10:111554826-111554848 CTGAGTTCAAAGCTAGAGTTTGG + Intergenic
1075271872 10:121059462-121059484 CTGAATTACAAGATGGAGGAGGG + Intergenic
1075650214 10:124123038-124123060 CTGAAACCAAGGCTTGAGGAGGG + Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1080039892 11:27748466-27748488 CTAAATTCAGATCTGGAGCATGG + Intergenic
1080615158 11:33939345-33939367 CTGACTTTGAAGCTGGAGGAAGG + Intergenic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1084248099 11:67873987-67874009 CTGCATTCCAACCTGGACGATGG + Intergenic
1084296692 11:68216716-68216738 CAGAATTCCAGGCTGGAGGCAGG + Intergenic
1084382004 11:68818517-68818539 CTGAAGTTATAGCTGGTGGAAGG - Intronic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1085167144 11:74413034-74413056 CTGAATTCTAGGCAAGAGGAAGG + Intergenic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1086416122 11:86590515-86590537 TTGCTTTCAAAGCTGGAGGCAGG + Intronic
1087204026 11:95375133-95375155 CAGAACTCCAAGATGGAGGAGGG + Intergenic
1087399512 11:97647276-97647298 ATGAGTGCAAAGCTTGAGGATGG + Intergenic
1088217614 11:107530207-107530229 CTTAAATCAAAGGTGGAAGACGG - Intronic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1088581963 11:111325358-111325380 CTTAATTCCAAGCCCGAGGAAGG - Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1090235240 11:125142094-125142116 CTGAACATAAAGCTTGAGGAAGG + Intergenic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1092418385 12:8309374-8309396 CTGCATTCCAACCTGGACGATGG + Intergenic
1092900627 12:13056236-13056258 GGGAATGCAAAGCTGTAGGAAGG + Intronic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095160187 12:38906056-38906078 CTGAGTTGAAAGCTGGAGGTGGG + Intronic
1095624359 12:44297004-44297026 CTGAATCCAAAGCTCGAAAAAGG + Intronic
1096356709 12:50947437-50947459 CTGACTTTAAAAATGGAGGAAGG - Intergenic
1096563309 12:52452330-52452352 CTCAAGTCAAAGCTGGAGGCAGG - Intergenic
1096565463 12:52473990-52474012 CTCGAGTCAAAGCTGGAGGCAGG - Intergenic
1096682697 12:53267460-53267482 CTGAATTCTTTGGTGGAGGAAGG + Intergenic
1096754727 12:53789684-53789706 CAGCATTGAAAGATGGAGGAAGG - Intergenic
1096783092 12:54001915-54001937 TTGAACTCCAAGCGGGAGGATGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097734309 12:63165243-63165265 CAGAATTCTAAGCTGGAAGTGGG + Intergenic
1098251345 12:68572840-68572862 CTGCATTCCAAGCAGCAGGAAGG - Intergenic
1099246277 12:80196918-80196940 CTGAATTATAAAATGGAGGAGGG - Intergenic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101842906 12:108340701-108340723 CTGAATTAAAGGATTGAGGATGG - Intergenic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102544570 12:113645482-113645504 CTGAATTCAAGAAGGGAGGAAGG + Intergenic
1102930653 12:116859658-116859680 CTGAGTTCAAAGCTGCGGGGTGG + Exonic
1103032948 12:117632533-117632555 CTGAAATCAAAGCTAGAAAAAGG - Intronic
1103954685 12:124569348-124569370 CTCTATTTGAAGCTGGAGGAGGG + Intergenic
1103992296 12:124807356-124807378 CTGGCCTCAAAGGTGGAGGAAGG + Intronic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1104484543 12:129139036-129139058 ACGATTTCAAAGCTGGGGGAAGG - Intronic
1104577811 12:129983853-129983875 CGGAAATCAAAACAGGAGGAAGG + Intergenic
1104657286 12:130582716-130582738 CTGAATCAGAAACTGGAGGAGGG + Intronic
1104710559 12:130982806-130982828 CTGAAGTGGAAGCTGGAGAAGGG + Intronic
1105903953 13:24785115-24785137 CTAAACTCAAAGCAGAAGGAAGG - Intronic
1106085812 13:26540594-26540616 CTCAATTCCAAGCTGGTGGCAGG - Intergenic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106566035 13:30885517-30885539 CTGAATTCCAAATGGGAGGAGGG - Intergenic
1107560604 13:41553890-41553912 CTGAAGACAAACCTGAAGGAAGG - Intergenic
1108041039 13:46339509-46339531 CGGAATTCAAACCTGCTGGAAGG - Intergenic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1108586030 13:51870681-51870703 CTGAATTCTAAGCTGGCAGTGGG + Intergenic
1108768623 13:53666999-53667021 CTAAATTAAAATATGGAGGAGGG - Intergenic
1109469967 13:62791449-62791471 CTGAATCCATTGCTGGAGGGGGG + Intergenic
1110597784 13:77338100-77338122 CTGGCTTTAAAGGTGGAGGAAGG + Intergenic
1110707088 13:78608589-78608611 CCGCATTCAAAGCTGGAAGAAGG + Intergenic
1111113968 13:83751753-83751775 CTGAATTGTCACCTGGAGGAAGG - Intergenic
1111186044 13:84736985-84737007 CTGAGTTCATACCTTGAGGAGGG - Intergenic
1112148473 13:96729376-96729398 CTGAACTAAAAGCAGGATGATGG + Intronic
1112429815 13:99341546-99341568 GTGTATTTAAAGCTGGAGGATGG + Intronic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113822607 13:113225722-113225744 CTGGAGTCAGAGCTGCAGGATGG + Intronic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1117046592 14:51818715-51818737 CTGGATTCAAAGCAGGAAAAAGG + Intergenic
1117100067 14:52336341-52336363 CTGACTTCAAAACTGGGGCAGGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117531027 14:56661012-56661034 CTGAAGGAAAAGCTGGAGGCGGG + Intronic
1118038031 14:61889410-61889432 CTGATTTCAATGTTGGAGGTGGG + Intergenic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118916893 14:70115238-70115260 CTGAATCCAAAGCTCGGGCAGGG - Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119571630 14:75679312-75679334 TTGACTTCAAAGATAGAGGAAGG + Intronic
1119727425 14:76930138-76930160 ACACATTCAAAGCTGGAGGAAGG - Intergenic
1119739680 14:77006251-77006273 CTGACAGCAAAGCTGGTGGAAGG - Intergenic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120595939 14:86435981-86436003 CTGAATTTAGAATTGGAGGATGG - Intergenic
1120974616 14:90237764-90237786 CTGGATTCATTGCTGCAGGAAGG - Intergenic
1121929859 14:97962743-97962765 CTGAAATCAAAGCGGCAGCAGGG + Intronic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1123704583 15:22941724-22941746 CTGTGTGCAAAGCTGGGGGAAGG - Intronic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1124104782 15:26727561-26727583 CTGATTTCAAGGCTGGGGTAGGG - Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128617010 15:69118103-69118125 CTGAATCAGAATCTGGAGGAGGG + Intergenic
1130053305 15:80502157-80502179 CTGAATTCAAAGAATGGGGAAGG + Intronic
1130135656 15:81179694-81179716 CTGACTTTAAAGATGCAGGAAGG - Intronic
1130219454 15:82006886-82006908 CTGGATTCAAACATGGAAGAAGG + Intergenic
1131144952 15:90004569-90004591 TTGACTTCAAAGCTGGAAGAAGG + Intronic
1132242854 15:100273708-100273730 CTAAATTCAAAGCTAGCAGAAGG + Intronic
1134312065 16:13083917-13083939 CTGGTTTCAAAGCGGGAGGGAGG + Intronic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1139764817 16:69218888-69218910 ATAAATTCAAAGCAGGAAGAAGG + Intronic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141346927 16:83255312-83255334 CGTAGTTCAAACCTGGAGGATGG - Intronic
1141360375 16:83390202-83390224 ATGCATTCAAAGCTGTATGAAGG - Intronic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1143499856 17:7332293-7332315 CTGAATTCAGGGCTGAGGGAAGG - Intergenic
1143680017 17:8469471-8469493 CTCAGTTGATAGCTGGAGGAAGG + Intronic
1144164304 17:12593619-12593641 CTGATATCAAAGCTAGATGAAGG - Intergenic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1146329782 17:31917555-31917577 CTCAATTCAGAGCTCCAGGAGGG - Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146792845 17:35762563-35762585 CTGAAGTCAAGCCTGGAAGAAGG + Intronic
1146886880 17:36476860-36476882 ATGACTTCAAAGCTGGATAAAGG - Intergenic
1146966185 17:37032468-37032490 CTGATTTCAGGGCTGGAAGATGG - Intronic
1149933693 17:60781980-60782002 CTGAATTTCTAGGTGGAGGATGG - Intronic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151354921 17:73552702-73552724 CTGACTGCAGAGCTTGAGGACGG + Intronic
1151582304 17:74987537-74987559 ATGTATGCAAAGCTGGAGGCGGG - Intergenic
1152323170 17:79619874-79619896 CTGAACTCCAACCTGGACGACGG - Intergenic
1152387686 17:79984902-79984924 CTGTGTCCGAAGCTGGAGGATGG - Intronic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1153167349 18:2277797-2277819 CTGGCTTCAAAGCTGAAAGAAGG - Intergenic
1153244184 18:3057475-3057497 CTGAGTTGTAAGCTGGAGCAAGG + Intergenic
1153617651 18:6949367-6949389 CTGAATGCAATGCTAAAGGAAGG + Intronic
1153637697 18:7127403-7127425 AGGAATTCAAAGGTGGAGAAAGG - Intergenic
1154211694 18:12384776-12384798 CTAAACTCAAAGCTAGATGAAGG + Intergenic
1155162682 18:23208450-23208472 CTTTATTAAAAGCTGGAAGAAGG - Intronic
1155197091 18:23485568-23485590 CTGAATTCCAAAGTGGGGGAAGG - Intronic
1155736510 18:29229440-29229462 CTAAATGCAAAGCTGGTAGAAGG - Intergenic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157151928 18:45227029-45227051 CTGTATTCAAGGCAGGAAGAAGG + Intronic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1159125128 18:64214892-64214914 CTGAATTGACAGGTAGAGGAAGG + Intergenic
1159190975 18:65041606-65041628 CTTAATTCAAAGTTGGTAGAGGG + Intergenic
1159241478 18:65749204-65749226 CTGAACTAAAAGCTTCAGGAGGG - Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG + Intergenic
1159758851 18:72399402-72399424 CTGATTTCACAGCTACAGGAGGG + Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1162356510 19:10188790-10188812 CTGACTTTAAAGGTAGAGGAAGG + Intronic
1162514817 19:11141673-11141695 CTGAATGCCAGGCTGGAGGAGGG + Intronic
1162954853 19:14091966-14091988 CTGACAGCTAAGCTGGAGGAGGG + Exonic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1163809056 19:19419050-19419072 CTGAATTCAAGGATGGTGGAGGG - Intronic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1164771257 19:30811021-30811043 CTAGAATCAAAGCTGGGGGAGGG - Intergenic
1165483761 19:36082807-36082829 CTGAGTTCCAGGCTGCAGGATGG + Intronic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167142789 19:47663512-47663534 CTGTATTCAAAACTGGAAGCAGG + Intronic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
925497235 2:4465750-4465772 CTGAATTTGAAGGTGTAGGAAGG + Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
926992049 2:18690462-18690484 CTGATTCCAAAGCTGTAGAAGGG - Intergenic
928340613 2:30440077-30440099 CTGACTTCAAAGGTGGAGGAAGG + Intergenic
928445989 2:31333611-31333633 CTGAATTCAAAGCTGACTTAGGG - Intergenic
928682063 2:33712765-33712787 CTGAATTCCAAGAGGTAGGAGGG - Intergenic
928807563 2:35178879-35178901 CTGGATTCTGAGATGGAGGAAGG - Intergenic
930091891 2:47536832-47536854 CTTAATTCTTAGCTGGAAGATGG + Intronic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
931856501 2:66307456-66307478 CTTTATCCAAAGCTGGAGAAAGG + Intergenic
932289736 2:70566730-70566752 TAGAATTAAAAGGTGGAGGAAGG + Intergenic
933285566 2:80381193-80381215 CTGATCTCCAAGCTGGGGGAAGG - Intronic
933286274 2:80387692-80387714 TTGAATTTAAAGCCAGAGGATGG + Intronic
933537933 2:83600770-83600792 CTGATATCAAAGCTGGACAAGGG + Intergenic
934508322 2:94915232-94915254 CTGGCTTCAAAGCTGGAAGGAGG - Intergenic
934811629 2:97283904-97283926 CTGCATTCGAGGCTGGTGGAGGG + Intergenic
934826062 2:97424036-97424058 CTGCATTCGAGGCTGGTGGAGGG - Intergenic
935554243 2:104490387-104490409 CTTCATTTAAAGCTGGAGTATGG - Intergenic
935670659 2:105554292-105554314 CTGTAATCAATGCTAGAGGAAGG - Intergenic
936245972 2:110827585-110827607 CTGAGTTCTTGGCTGGAGGAAGG + Intronic
937162764 2:119781194-119781216 CTGATTTCAGAGCTGGGGCAAGG - Intronic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
938112693 2:128579534-128579556 TTGAACACAAAGCTTGAGGATGG - Intergenic
938259745 2:129887073-129887095 CTGAATTCCAAAATGGATGAGGG + Intergenic
938631715 2:133174721-133174743 TTGATTCCAAAGCTGGAGCAGGG - Intronic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939820939 2:146956047-146956069 CAGAATACAAAGCTGGAAAAGGG + Intergenic
940029003 2:149240794-149240816 CTGAGAACAAAGCTGTAGGAGGG - Intergenic
940274551 2:151925612-151925634 CTGAATTCAAAGGAGTAGGGTGG + Intronic
940341693 2:152588265-152588287 TTGGCTTTAAAGCTGGAGGAAGG - Intronic
941952810 2:171174265-171174287 GGAAATTCCAAGCTGGAGGAAGG - Intronic
942193002 2:173489582-173489604 CAGATTTCATATCTGGAGGAGGG - Intergenic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
943715675 2:191150209-191150231 CTGAATTCAAAGCTGAAAAAAGG + Intronic
944314203 2:198267990-198268012 TGGAACTCAAAGCTTGAGGATGG + Intronic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
946197158 2:218040581-218040603 CTGACTTCATACCTGGAGGCAGG + Intronic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947432226 2:230040965-230040987 CTGAGGTCAAACCTGCAGGAGGG - Intronic
1171058659 20:21934024-21934046 CTGCATTCCAACATGGAGGACGG - Intergenic
1172185253 20:33027472-33027494 CTGAATTTAGAGCTGGGGTAGGG + Intergenic
1172514522 20:35523682-35523704 CTGAATGCCAAGGTGAAGGAGGG - Intronic
1172706660 20:36887169-36887191 CTGCTTCCAAAGCTGGAGGGAGG - Intronic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173382911 20:42561981-42562003 CTGATTTCAACGCTGGAGCCAGG - Intronic
1173817264 20:45997804-45997826 ATGAATAGGAAGCTGGAGGAGGG + Intergenic
1173941510 20:46914926-46914948 CTGCCTTCAAAGCTGGAGTATGG + Intronic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174862342 20:54102667-54102689 CAGAATACAAAGCTGGATGCAGG - Intergenic
1175065291 20:56279376-56279398 CTGATTTCAGGGCTGGAGCAGGG + Intergenic
1175282115 20:57810958-57810980 CTGCATTCCACGCAGGAGGAGGG + Intergenic
1175446336 20:59022827-59022849 CAGAACTGAAAGCAGGAGGAAGG - Exonic
1175661759 20:60819606-60819628 CTAAAATAAAAGCAGGAGGAGGG + Intergenic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1178395813 21:32242241-32242263 CTGAATCCACATCAGGAGGAGGG + Intergenic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179823452 21:43950821-43950843 CTGCGTTTAAAGCGGGAGGAAGG + Intronic
1180844438 22:18973543-18973565 ATGAATTCAAGGCTGGGGCAGGG - Intergenic
1181057035 22:20265168-20265190 ATGAATTCAAGGCTGGGGCAGGG + Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182061177 22:27398960-27398982 CTGACTTCCAAGCTGGCAGAAGG - Intergenic
1182648738 22:31832982-31833004 CTGAGAAGAAAGCTGGAGGAAGG - Intronic
1183659324 22:39209356-39209378 CTGCATTCAAGGCAGGAAGAAGG + Intergenic
1183695916 22:39422083-39422105 CTGGGTTCAAAGCTGGGGGAAGG + Intronic
1184268546 22:43364058-43364080 CTGCATTCAGAGCTTGGGGAAGG + Intergenic
1184825336 22:46946769-46946791 CTGAATACCAACCTAGAGGAAGG - Intronic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
950355073 3:12400781-12400803 CTAAATTTAGAGCTAGAGGAAGG + Intronic
951186262 3:19717012-19717034 CTGAACTCAAAGCTGCAGGGAGG - Intergenic
952394340 3:32908013-32908035 CTGCATTCCAGGCTGGATGATGG - Intergenic
952442388 3:33345153-33345175 CTGAATTCAAAGTGTGAGCATGG + Intronic
952927152 3:38328683-38328705 ATGAATCCAAAGCTGGGTGAGGG - Intergenic
953221628 3:40977132-40977154 CAGGAATCAATGCTGGAGGAAGG - Intergenic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
954322976 3:49844482-49844504 CTGACTTGGATGCTGGAGGAAGG - Intronic
954436388 3:50498535-50498557 CATAACTCAAAGCTGGGGGAAGG + Intronic
954562404 3:51568933-51568955 TTGAGTGCAAAGCTTGAGGATGG + Intronic
954861826 3:53696677-53696699 CTGGATTCAAAGATGGGAGAAGG + Intronic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
957408954 3:79811752-79811774 TTGAAACCAGAGCTGGAGGAAGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
959053286 3:101544812-101544834 CTGATCTCAAAGCTTAAGGATGG + Intergenic
960988067 3:123293144-123293166 CTAAGGTCAATGCTGGAGGAAGG + Intronic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961770732 3:129248273-129248295 GTGACCGCAAAGCTGGAGGAAGG - Intergenic
961896064 3:130168593-130168615 CTGCATTCCAACCTGGACGATGG + Intergenic
962154062 3:132925739-132925761 CTGAATTAGAAACTGGAGCAAGG + Intergenic
962274626 3:134002659-134002681 CTGAATGAAAAACTGGAGGTGGG - Intronic
962551066 3:136492461-136492483 CTGAATTCAAGACTGCATGACGG + Intronic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963617467 3:147559824-147559846 CTGGATTTGAAGGTGGAGGAAGG - Intergenic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964741088 3:159966874-159966896 CTGAACTCATAGCAGGAAGAGGG + Intergenic
965717081 3:171616642-171616664 CTGACTTTAAAGGTGGAAGAAGG + Intronic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967023566 3:185544300-185544322 CTGAATTCTACCCTGGAGAATGG + Intronic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
969182449 4:5452457-5452479 CTCCATTCAAAGGAGGAGGAAGG + Intronic
969746697 4:9078380-9078402 CTGCATTCCAACCTGGACGATGG - Intergenic
970492997 4:16595104-16595126 CTGAATTCAAAGCCCCATGAAGG - Intronic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970664867 4:18325177-18325199 CTTCATTCCAAGCTGTAGGATGG + Intergenic
971007631 4:22392775-22392797 CTGATTTGAAAGCAGCAGGAAGG + Intronic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972210485 4:36830720-36830742 CTTAAATCAAAGCTTGAAGAAGG + Intergenic
972337639 4:38121966-38121988 TTGAATTCAGAGTTGAAGGAAGG - Intronic
973264838 4:48200774-48200796 CTGAATTGCAAGCTGGAGGAAGG - Intronic
973298301 4:48551803-48551825 CTGAATCCAAAGGTGGTGGTGGG + Intronic
973574249 4:52270155-52270177 CAGAATTCAAAATTGGAGTAAGG + Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973723378 4:53748274-53748296 CTGAATTCAGCCTTGGAGGAGGG - Intronic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
976241752 4:82965394-82965416 TTAGATTCAAAGCTGGAGGAGGG + Intronic
976399651 4:84593412-84593434 TTGAGCTCAAAGCTTGAGGATGG + Intronic
977434875 4:96981581-96981603 ATGAAATCAAGGCTGAAGGAAGG + Intergenic
977452249 4:97213537-97213559 CTGAAATCATTGCTGGAGAATGG - Intronic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
978593550 4:110352471-110352493 CTGAATGCCAAACTGGAGTAGGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978906742 4:114013643-114013665 TTAAATCCAAAGCTGGGGGAGGG - Intergenic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
980078068 4:128314866-128314888 CTGCATTCTGAGCTGGAGGAGGG - Intergenic
980851743 4:138390594-138390616 CTGGTTTTGAAGCTGGAGGAAGG + Intergenic
981685183 4:147446480-147446502 TTGAATTCAAAGCTGGATACAGG - Intergenic
981890633 4:149732127-149732149 ATGATTTCAAAGCTGTAGGTGGG - Intergenic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
982790384 4:159585493-159585515 CTTAATTCAAAAGGGGAGGAGGG - Intergenic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
988064164 5:26213770-26213792 CTGGTTTCAAAGCTGAAGCACGG + Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
989101237 5:37825386-37825408 CTGACTTAAAAGCTGAAGAATGG - Intronic
989433244 5:41380141-41380163 CTGAATTTAAAGCATGAGTAAGG - Intronic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
989531912 5:42517337-42517359 CTGAATTGAAAGCTCCAGGAAGG + Intronic
990133574 5:52618116-52618138 GTGAATTCAAAGCTTGAATACGG + Intergenic
990878095 5:60509615-60509637 GTGAAGTCAAAGGTGGATGAAGG - Intronic
991113465 5:62927603-62927625 CTGAGTCTAAAGCTTGAGGATGG + Intergenic
991264271 5:64698636-64698658 ATAAATTCAAAGCAGGAAGAGGG - Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992334886 5:75756382-75756404 GTGAAGTCAAAGGTGGAGCATGG + Intergenic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
993804274 5:92384829-92384851 CTGGCTTGGAAGCTGGAGGAAGG - Intergenic
993933786 5:93975406-93975428 TTAAATTCAAAGCTGGTAGAAGG + Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995187272 5:109285152-109285174 CTAAATTCAAAGCTAGTGGAAGG + Intergenic
995482245 5:112604871-112604893 CTGAATTCAGAAATGGTGGAGGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
999594263 5:153184684-153184706 GGGACTCCAAAGCTGGAGGAAGG + Intergenic
1000654356 5:163858216-163858238 ATGAATTTAAGGCTGGGGGAAGG + Intergenic
1001309365 5:170599779-170599801 CATAAGTCAACGCTGGAGGAAGG - Intronic
1001438619 5:171720510-171720532 CTGACTTCAAAGTTTAAGGAGGG - Intergenic
1001449043 5:171810051-171810073 CAGACAGCAAAGCTGGAGGAAGG + Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1001930319 5:175668351-175668373 CAGAATTCTCAACTGGAGGAAGG - Intronic
1001986414 5:176077076-176077098 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002230453 5:177761049-177761071 CTGAATCCACAGCAGGAGGTTGG + Intronic
1002264883 5:178022698-178022720 CTGAATCCACAGCAGGAGGTTGG - Intronic
1002322304 5:178383148-178383170 CTGCACCCAGAGCTGGAGGAGGG - Intronic
1003307162 6:4940006-4940028 GGGAATTCAACGCTGGAGGGAGG - Intronic
1003616700 6:7660900-7660922 CAGAACTCAAGGCTGGATGAGGG - Intergenic
1003777134 6:9380111-9380133 CTGCATTCCAGGCAGGAGGAAGG - Intergenic
1004588889 6:17029864-17029886 CAGAATGGAAAGGTGGAGGAAGG + Intergenic
1004977673 6:20985764-20985786 CTGCATTCCAACCTGGATGATGG + Intronic
1005346696 6:24897460-24897482 CGGAATCCAAATCTGGAGGATGG - Intronic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005353365 6:24959053-24959075 GTAAGATCAAAGCTGGAGGATGG - Intronic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005925981 6:30446089-30446111 ATGAATCCAAAGATGGAAGAGGG - Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1006978693 6:38127864-38127886 CTGAAACCTAAGCTGAAGGAAGG - Intronic
1007732973 6:43961992-43962014 TTGAAATCAAAACTGAAGGAGGG + Intergenic
1008359099 6:50593564-50593586 CAGGTTTCAAGGCTGGAGGAAGG + Intergenic
1008391529 6:50957690-50957712 CTGAATTGAATGCTGCAGCAGGG - Intergenic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1009465252 6:63961171-63961193 CTTACTTCAAAGATGGTGGAAGG + Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009976704 6:70678761-70678783 CTAGTTTCAAAGATGGAGGAAGG - Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1013142923 6:107357648-107357670 CTGAATTTAGAGCTGGAGGTTGG - Intronic
1013244644 6:108274940-108274962 CTGAGCCCAAAGCTTGAGGATGG - Intergenic
1013297735 6:108774618-108774640 CTGCATTCTGATCTGGAGGAGGG + Intergenic
1013515281 6:110879539-110879561 CTGAATTCACTGCCGCAGGAAGG + Intronic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1015240927 6:131022423-131022445 TTGAATATAAAGCTGGTGGAGGG - Intronic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016964825 6:149709204-149709226 CTGAATTCCAACAGGGAGGAGGG - Intronic
1017030576 6:150217932-150217954 ATGTAATCAAAGCTGGAGGTTGG - Intronic
1017139446 6:151177587-151177609 CTGATTTCAAAGCCTGAGCAAGG + Intergenic
1019132501 6:169887588-169887610 CTGAATTCAGAGCTCTATGAGGG + Intergenic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1019377259 7:699434-699456 CAGAGGTCACAGCTGGAGGAAGG + Intronic
1019742820 7:2683254-2683276 CTGAAGTCAAGGCTGGGGCAGGG + Intronic
1019860935 7:3657503-3657525 CTGGATTTAAAGCAGGAAGAGGG + Intronic
1020326761 7:6980198-6980220 CTGTATTCTAACCTGGACGATGG + Intergenic
1020478122 7:8623158-8623180 CTGAATTTAATGATGCAGGAGGG + Intronic
1020812529 7:12864414-12864436 CTGAGTTCACAGCTGCAGAAGGG + Intergenic
1020865255 7:13552138-13552160 TTGAATACAAAGGTGGTGGAAGG - Intergenic
1021107659 7:16656994-16657016 CTGACTCCAAGGCTGGAGCAGGG - Intronic
1022488115 7:30795804-30795826 CTGGCTTCAAAGGTGAAGGAAGG - Intronic
1022532018 7:31072920-31072942 CTGGTTTCAAAGAGGGAGGAAGG + Intronic
1022887495 7:34661579-34661601 CAGAATTCAAGGGTGGAGGTGGG - Intronic
1024039818 7:45543587-45543609 TTGATTTAAAAGCTGGAGAAAGG - Intergenic
1024395520 7:48862309-48862331 CTGCATTCCAAGCAGGAAGAAGG + Intergenic
1024399712 7:48909968-48909990 CTGCATTCCAAGCAGGAAGAAGG - Intergenic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1027421932 7:78025197-78025219 CTGACTTCTCTGCTGGAGGAAGG + Intronic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1030096385 7:105904289-105904311 CTGCATTCTAGGCAGGAGGAAGG + Intronic
1030507553 7:110443918-110443940 CTGGATTCAAAGATGCAGGAGGG - Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1030975371 7:116115481-116115503 CACACTTCAAAGATGGAGGAAGG - Intronic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1033082368 7:138310346-138310368 CTGAATTGCATGCTGAAGGATGG - Intergenic
1033248704 7:139740231-139740253 CTAAATTCAAAGCAGGAGTCAGG + Intronic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033560079 7:142522499-142522521 CTGAGGTCAGAGCTGCAGGAGGG - Intergenic
1034306818 7:150049740-150049762 CTGGATTGAAAGCTTGGGGAAGG - Intergenic
1034718802 7:153268437-153268459 CTGAATGTAAAGCTGTAGCATGG + Intergenic
1034800027 7:154050903-154050925 CTGGATTGAAAGCTTGGGGAAGG + Intronic
1034817810 7:154188563-154188585 ATGAATTCAAAACTGGAAGGAGG + Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1036838997 8:12100933-12100955 CTGAATTCCAGGCAGCAGGAAGG + Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037431011 8:18813193-18813215 CTGACTTAAAAGCTGGTGGAAGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038506750 8:28091296-28091318 CTGAATTCTAAAAAGGAGGAGGG + Intronic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1040020884 8:42739904-42739926 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1041589255 8:59557874-59557896 CTGCATTCAAAGTCGGAGCAGGG - Intergenic
1041733554 8:61087081-61087103 TTGATTTCGGAGCTGGAGGATGG - Intronic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042467310 8:69142020-69142042 CTGATTTCAAAGGCGGAGGAGGG - Intergenic
1042946827 8:74163622-74163644 CTAAGTTCAAAACTGAAGGATGG + Intergenic
1043753483 8:83970793-83970815 CTGACACCTAAGCTGGAGGATGG - Intergenic
1043880562 8:85537842-85537864 CTCAATACAAAGCAAGAGGATGG - Intergenic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1045566818 8:103325669-103325691 CTGAAGCTAAAGCTTGAGGAAGG - Intronic
1048736595 8:137508906-137508928 CTGAATTCCCTGCTGAAGGATGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049350622 8:142162602-142162624 CTGAATTCAAGGATGGATGGAGG + Intergenic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1050184413 9:2957759-2957781 CTGAATTCCAGGCAGGAGGCAGG - Intergenic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052654984 9:31347342-31347364 TAGAATTGAAGGCTGGAGGATGG - Intergenic
1053274196 9:36770974-36770996 CTGAGTTCAAGGCTGAAGAAAGG - Intergenic
1053459503 9:38257676-38257698 CTGAATCAAAACCTGGAGGTGGG + Intergenic
1055005886 9:71505617-71505639 CTGAATTTGAACTTGGAGGATGG + Intergenic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056673685 9:88654650-88654672 CTGCATTCCAAGCAGGAAGACGG - Intergenic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1058476754 9:105342508-105342530 CTGAGATGAAAGCTGAAGGAGGG - Intronic
1058929740 9:109707373-109707395 CTGACTTCAAAGCTGGGGCAGGG - Intronic
1059413688 9:114150037-114150059 CTGAATTCCAGGCTGGAGTGAGG - Intergenic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1060429126 9:123533688-123533710 CTCTGTTCAAAGCTGCAGGAAGG + Intronic
1060762528 9:126267918-126267940 CTCAGTTCAATGCTGGATGATGG - Intergenic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062353304 9:136149582-136149604 TTTAAATCAAAGATGGAGGAGGG + Intergenic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1185817358 X:3168727-3168749 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186821030 X:13288176-13288198 TTGAGTGCAAAGCTTGAGGATGG - Intergenic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188753583 X:33933440-33933462 CTGATACCAAGGCTGGAGGAGGG - Intergenic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1189894155 X:45636118-45636140 CTGATTTTAAAGCTAAAGGAAGG - Intergenic
1190081855 X:47362875-47362897 CTGAATGCTAAGCTGCAGAAAGG - Intergenic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1192540806 X:71970724-71970746 CTAAATTCAAAGCAAGAAGAAGG - Intergenic
1193698028 X:84732966-84732988 TTAAATTCAAAGCTAGAAGATGG - Intergenic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1194026025 X:88752062-88752084 CTGAATTCCATGGTGGAGAAAGG - Intronic
1194092273 X:89592605-89592627 CTGAATTCCAAAGGGGAGGAGGG - Intergenic
1194467295 X:94248922-94248944 ATGAATTCACAGCTTGAGAAAGG + Intergenic
1194937854 X:99972536-99972558 CTGTATTCTAAGCAGAAGGACGG - Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1196963769 X:121032750-121032772 CTGAATTTGAAGATGAAGGACGG - Intergenic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1198743001 X:139860914-139860936 CTGAGATCAAAGCATGAGGAAGG + Intronic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1201290130 Y:12414667-12414689 CTGAATTCCAAAATGGAGGAGGG - Intergenic