ID: 955884813

View in Genome Browser
Species Human (GRCh38)
Location 3:63586492-63586514
Sequence CTGGGGATAGGGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 3, 3: 89, 4: 789}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955884813_955884822 20 Left 955884813 3:63586492-63586514 CCTTCTTCCATCCCTATCCCCAG 0: 1
1: 0
2: 3
3: 89
4: 789
Right 955884822 3:63586535-63586557 TGAGTTTCTTGTATCCTTGAGGG 0: 1
1: 0
2: 1
3: 23
4: 211
955884813_955884821 19 Left 955884813 3:63586492-63586514 CCTTCTTCCATCCCTATCCCCAG 0: 1
1: 0
2: 3
3: 89
4: 789
Right 955884821 3:63586534-63586556 ATGAGTTTCTTGTATCCTTGAGG 0: 1
1: 0
2: 2
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955884813 Original CRISPR CTGGGGATAGGGATGGAAGA AGG (reversed) Intronic
900005172 1:40582-40604 TTGGGGATGGGGATGGAAGTGGG - Intergenic
900117631 1:1035207-1035229 CTGGGCAAAGGGATGGGACAGGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
900782793 1:4628874-4628896 CTAGGGTTAGGGGTGGAGGAGGG + Intergenic
901146074 1:7065432-7065454 ATGGGGATGGGAATGGAGGAAGG + Intronic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
901685771 1:10942551-10942573 GTGGGGAGAGGGCTGGAAGGGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902693784 1:18126839-18126861 CTGGTGGTAGGGGTGGAGGATGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
903221632 1:21872761-21872783 CTGGGTAGACGGATGGAAGGAGG + Intronic
903268698 1:22174348-22174370 CAGGAGAGAGGGATGGAAGAAGG - Intergenic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903656903 1:24955064-24955086 ATGGGCAAAGGTATGGAAGAAGG - Intronic
903692810 1:25186222-25186244 CTGGTGATTGGGGTGGAAGGAGG - Intergenic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905245540 1:36610653-36610675 CTGGGCAGAGGGAGGGAAAAAGG + Intergenic
905250160 1:36643297-36643319 CTGGGGCTGGGGATGGAACTGGG - Intergenic
905324462 1:37140924-37140946 CAGGGGATAGGGAAGAAAGTGGG - Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905964442 1:42080538-42080560 CTGGGGATGGGGATGCCAGGTGG + Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906248925 1:44296369-44296391 GTGGGGAAAGGAATGGAAGGAGG - Intronic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907391539 1:54161427-54161449 CAGGGGAGTCGGATGGAAGAGGG + Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
911592053 1:99759504-99759526 CTGGGGATAGAGGTGGAAATAGG + Intronic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
913108862 1:115640618-115640640 CTGGGGGTGGGGGAGGAAGATGG + Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913193370 1:116432408-116432430 CTGAGGAGAGGGATGAAAGCAGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
915128480 1:153681359-153681381 CTGGGAATAGGGAAGGATGGAGG - Intronic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915903942 1:159864660-159864682 CTGTGGTTAGGGTTGGAACATGG + Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916572165 1:166037499-166037521 ATGTGGATAGTGAAGGAAGAGGG + Intergenic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917808990 1:178639160-178639182 CTGGGGCTAGGGATGGGAATAGG - Intergenic
917815536 1:178706177-178706199 GCGGGGTTAGAGATGGAAGATGG + Intergenic
918211596 1:182356280-182356302 TTGGGGAAAGGGATGGTAAAGGG + Intergenic
918950033 1:191125451-191125473 CTGAGGATGGGGTTGGGAGAAGG - Intergenic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920547336 1:206829381-206829403 GTGGGGAGAGGAAAGGAAGAGGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
922067532 1:222158546-222158568 GTGGAGCTAGGGATGGAATATGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922669012 1:227494897-227494919 CTGGGGGTGGGGATAGGAGAGGG - Intergenic
922670585 1:227506405-227506427 CTGGGGGTGGGGATAGGAGAGGG + Intergenic
923039667 1:230310535-230310557 ATGGGGACAGGAATGGAAAAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923697749 1:236270850-236270872 CTGGGGTAGGGGATGGATGATGG + Intronic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
924016845 1:239735981-239736003 TTGGGGATAGGCATTGAAGTTGG - Intronic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1062794466 10:333374-333396 CTGGGGCTAGGGCTGGAAATGGG - Intronic
1063080496 10:2763021-2763043 CCGGGGAGAGGGCTGGAAGGAGG + Intergenic
1063483768 10:6400207-6400229 CTGGGGCTACAGATGAAAGAAGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1065490013 10:26273362-26273384 CTGGTGATAGGTTTGGGAGAGGG + Intronic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066402513 10:35090046-35090068 GTGGGGAGAGGGATGAAAGGGGG - Intronic
1067023989 10:42827594-42827616 GTGGGGATAAGGAAGCAAGAGGG - Intronic
1067546568 10:47196447-47196469 CAGGTGAGAGGGTTGGAAGAGGG - Intergenic
1068395631 10:56457348-56457370 CTGGGGATGAGGATGCCAGATGG - Intergenic
1068543132 10:58318673-58318695 CTGGAGAGAGGAAAGGAAGAAGG - Intergenic
1069071179 10:63991914-63991936 ATGGGGATTGGGATGGGAGTAGG + Intergenic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069577897 10:69543819-69543841 AGGGGGAGAGGGAAGGAAGAAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1070094347 10:73322285-73322307 CTGGGAACAGGGATAGAAGGAGG - Intronic
1070505844 10:77112010-77112032 CTGGGGACAAGGTTGGAAGTTGG - Intronic
1070525173 10:77290020-77290042 CAGGGGTTAGAGATGGAAGGAGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071304533 10:84286818-84286840 CTGGAGTTAGGGATGGAGTAGGG + Intergenic
1071445138 10:85738831-85738853 CTGGAGGTGGGGATGGGAGAAGG + Intronic
1071731533 10:88253441-88253463 CTGGGGACAGGGGTGCCAGATGG + Intergenic
1071862175 10:89685523-89685545 CTTGGGCTAGGGAAGGATGAGGG + Intergenic
1072039878 10:91596841-91596863 TTGGGGAGGAGGATGGAAGAGGG + Intergenic
1072234146 10:93438682-93438704 CTAGGGATAGGGAAGGCAGAAGG + Intronic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1074161667 10:110841045-110841067 CTGGGGATAGGTGTGGTACAGGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074972502 10:118550656-118550678 CTGGTGATCAGGTTGGAAGATGG + Intergenic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075455032 10:122579535-122579557 CTCATGATAGGGATGGATGAAGG + Intronic
1075456095 10:122586017-122586039 CTCATGATAGGGATGGATGAAGG + Intronic
1075456588 10:122588901-122588923 CTGCTGATAGGGATTGATGAAGG + Intronic
1075458222 10:122598731-122598753 CTCATGATAGGGATGGATGAAGG + Intronic
1075842518 10:125517241-125517263 CTGTGGAAAGTGTTGGAAGATGG + Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076217105 10:128703861-128703883 CGGGGAATAGTGCTGGAAGATGG + Intergenic
1076709054 10:132321074-132321096 CTGGAGAGTGGGATGGAACACGG + Intronic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076774716 10:132688317-132688339 CTGGGGGCAGGGCTGCAAGAAGG - Intronic
1077169191 11:1158832-1158854 CTGGGGACAGGGCTGGGCGAGGG - Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077462645 11:2718304-2718326 CTGGGGCTAGGGATGGAGTGTGG - Intronic
1077613825 11:3661073-3661095 CTGGGGCGAGGCATGGAAGAGGG + Intronic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078798014 11:14612987-14613009 ATGGAGATAGGGAAGGAACATGG + Intronic
1079031323 11:16988354-16988376 CTGGGCAGAGGAATGGCAGAAGG + Intronic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1080315295 11:30940375-30940397 CTGGGGAGAGGTAAAGAAGAGGG - Intronic
1080658074 11:34273609-34273631 CCGAGGAGAGGGATGGAACAGGG + Intronic
1080665122 11:34329351-34329373 GTGGGAAGTGGGATGGAAGATGG - Intronic
1080928745 11:36785226-36785248 CTGGGGAAGGGGATAGAACAGGG + Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081851032 11:46275459-46275481 CTGGGGAAAGGGGTGGCAGGGGG - Intergenic
1081874194 11:46397580-46397602 ATGGGGACAGGGGAGGAAGAGGG + Exonic
1082816596 11:57513909-57513931 CTGGGGGGAGGGATGGCAAAGGG - Intronic
1083264011 11:61537805-61537827 GTGGGGACAGAGATGAAAGATGG + Intronic
1083357888 11:62080821-62080843 CTGGGGAGCAGGATAGAAGAGGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083490022 11:63009217-63009239 CTGGGGATTGGGATGAAGGAGGG + Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083615500 11:64024052-64024074 CTGGGGACAGGGCTTGGAGAGGG - Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084443436 11:69189499-69189521 CTGGGGATGGGGGTGCAGGAGGG + Intergenic
1084445115 11:69199148-69199170 ATGGAGATATGGATGGATGATGG - Intergenic
1084677620 11:70645352-70645374 CTGGGGATAGGGCTGGACATGGG + Intronic
1085768396 11:79304042-79304064 TTGGGAAAAGGGTTGGAAGAAGG + Intronic
1086992523 11:93319678-93319700 CTGGGAGTTGGTATGGAAGAGGG + Intergenic
1087304605 11:96473418-96473440 CTGAGGATGGGGATGTCAGATGG - Intronic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087763869 11:102128959-102128981 TTGGGGATAGGGAAGCGAGAGGG - Intronic
1088500546 11:110478365-110478387 CTGGGGATAGGCAAGGGTGAGGG - Intergenic
1088693875 11:112349819-112349841 CTGGGGACAGGAAAGGAAGGGGG + Intergenic
1088788146 11:113201060-113201082 GTGGAGACAGGGATGGAAAAGGG - Intronic
1088810484 11:113388366-113388388 CTGGAGAGAAGGATGGAAGCAGG - Intronic
1088989043 11:114935560-114935582 CTGGAGGTAGGTATGGAAGGAGG + Intergenic
1089127461 11:116186806-116186828 CTGGGCATAGGGTTGGAAGTAGG - Intergenic
1089291289 11:117439214-117439236 GTGGGGACAGGGATGGAGAAAGG - Intronic
1089433614 11:118443187-118443209 CTGGGAATAGGGAGGAAAAAGGG + Intronic
1089453443 11:118612097-118612119 CTGGGGCTAGGGGTGGAATGAGG - Intronic
1089489629 11:118874133-118874155 CTGGGCATTTGGATGGCAGAGGG - Intergenic
1089710426 11:120310619-120310641 CTGGGGATGGTGATGGTTGAAGG + Intronic
1089816548 11:121182068-121182090 CTGGGGACAGGGATGCCAGATGG + Intronic
1089944404 11:122453201-122453223 CTGAGGATAGGAATGAAAGTAGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1091045154 11:132318739-132318761 CAGGGGATTGGGATGGAAGGTGG - Intronic
1091379159 12:44757-44779 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1091400443 12:177736-177758 CTGGGGACAGGGATGGAGAGGGG - Exonic
1091716083 12:2777112-2777134 CAGGGAATAGGGATGTGAGAAGG - Intergenic
1091973005 12:4804000-4804022 CTGGGGAAAGGGGTGAATGAGGG + Intronic
1092246123 12:6865317-6865339 CTTGGGATAGCTATGGGAGAAGG + Intronic
1092844149 12:12568543-12568565 CTGGGCATAGGTAAGCAAGAAGG - Intergenic
1093104086 12:15065454-15065476 CTGGGGATGGGGATGTCAGGTGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093667615 12:21833116-21833138 TTGGGGTGAAGGATGGAAGAGGG + Intronic
1093787384 12:23208193-23208215 CTGAGGATAGGGATGGCCAAAGG - Intergenic
1094545203 12:31398321-31398343 CTGGGGAAAGGCATTGATGATGG - Exonic
1095212626 12:39510812-39510834 CTGGGGACAGGGATACCAGATGG - Intergenic
1095825307 12:46524800-46524822 CTGGGGATGGAGATGGGAGGAGG + Intergenic
1095930978 12:47624699-47624721 CTGGGGAAAGGGATGGCTGTGGG + Intergenic
1096750259 12:53754105-53754127 GTGGGGATGGGGATGGATAATGG + Intergenic
1096972580 12:55679705-55679727 CTGAAGATGGGGATGAAAGAGGG + Intergenic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1098573901 12:72019186-72019208 CTTGGGCTAGGGATGGCAGGGGG - Intronic
1099973599 12:89524933-89524955 CTGGGGGCCGGGATGGCAGAGGG + Intronic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100437488 12:94584866-94584888 ATGGGGATAGGGAATAAAGAAGG + Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1101759881 12:107649812-107649834 CTGGGGAGAGTGAAGGAAGCAGG - Intronic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1102163267 12:110786302-110786324 TTGGGGTGAGGGATGGAAGGTGG + Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102199478 12:111047498-111047520 CTGGGGCTAGGGCTGGAGAATGG + Intronic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102654469 12:114469909-114469931 CTGGGGATGGGGGTGGGAGAAGG - Intergenic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102763086 12:115406819-115406841 TTGGGGAAAGGTATGGATGAAGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103693310 12:122793480-122793502 CTGGGGGTAGGTAAGGAATATGG + Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104723722 12:131061793-131061815 CAGGAGTTAGGGATGGTAGAAGG - Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104850636 12:131871906-131871928 CAGGGGATGGGGAGGAAAGAAGG + Intergenic
1104895070 12:132160009-132160031 CTGGGGAAACGAATGAAAGAAGG - Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106323656 13:28666766-28666788 GTGGTGATAGTGATGGAAGATGG + Intronic
1106667244 13:31864652-31864674 CCTGGGATAGTGATGGAAAAAGG + Intergenic
1106770593 13:32957617-32957639 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1107139614 13:36983813-36983835 CAAGGGATGGGGATGGATGATGG + Intronic
1107726405 13:43304082-43304104 CTGGGCACAGGGATGCAACAGGG - Intronic
1107799808 13:44095160-44095182 CACGGGAAAGGGATGCAAGATGG - Intergenic
1107822143 13:44295840-44295862 CTGGGGCTTGGGATGGAGAAGGG - Intergenic
1108308770 13:49165509-49165531 CTGGGGATGGGGATGTGAGGTGG + Intronic
1109629717 13:65031373-65031395 CTGGGGACAGGGATGTCAGTTGG + Intergenic
1109838225 13:67886772-67886794 CATGAGATGGGGATGGAAGATGG + Intergenic
1110255694 13:73431399-73431421 CTGGTGACAGGGATGATAGAAGG + Intergenic
1110336985 13:74344864-74344886 CTGGGGATTGGAATGCCAGATGG + Intergenic
1112116663 13:96363000-96363022 CATGGGTTAGGGATGGGAGAGGG + Intronic
1113375613 13:109762699-109762721 CTGGGGACAGGGAGGTGAGAAGG - Intronic
1113414894 13:110120918-110120940 GAGGGGAGAAGGATGGAAGAGGG - Intergenic
1113438787 13:110312447-110312469 CTGGGGAGAGGGAAAGAAAATGG + Intronic
1113741249 13:112713971-112713993 CTGGGGCCAGGAATGGAAGCTGG - Intronic
1113873742 13:113581659-113581681 CTTGCCATAGTGATGGAAGAAGG + Intergenic
1114207578 14:20587422-20587444 CTAGGGAGAGGGATAGAAAAAGG + Intronic
1114265554 14:21070841-21070863 TTGGGGACAGGGATGGAAAATGG - Intronic
1114570660 14:23665227-23665249 CTGGGAATAGGGGGAGAAGAAGG - Intergenic
1114985258 14:28218266-28218288 CTGCTGCTAGGGATGGAGGATGG + Intergenic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1116502678 14:45639361-45639383 CTGGGGTTGGGGTTGGAGGACGG + Intergenic
1116715187 14:48417748-48417770 CTGGGGATGGGGTTGCAAGATGG + Intergenic
1117642493 14:57814763-57814785 CTGGGTATGGCGATGGAATAGGG + Intronic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1118312904 14:64706002-64706024 CTGGGGATGGGGCAGGAAGTTGG + Intronic
1118358936 14:65039585-65039607 CAAAGGATAGGGATGGGAGAGGG - Intronic
1118610561 14:67536300-67536322 CTGGGGATGAGGCTGGGAGAAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119654844 14:76409778-76409800 TGGGGGATGGGGATGGGAGATGG + Intronic
1120711016 14:87793301-87793323 CTGGGGATAGAAATAGAAGTGGG - Intergenic
1121498335 14:94413330-94413352 AAAGGGATAGGAATGGAAGAGGG - Intergenic
1121687154 14:95844925-95844947 CAGGGGCTAGGGGTGGAAGGAGG - Intergenic
1122197194 14:100097353-100097375 ATGGGGATGGGGTTTGAAGAAGG - Intronic
1122599585 14:102914654-102914676 CTGGGCACAGGGCAGGAAGAGGG + Intergenic
1122775609 14:104115835-104115857 ATGGGGGTGGGGATGGAAGTGGG - Intergenic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1123080607 14:105691927-105691949 CTGAGGACAGGGATGGACGCTGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1124011194 15:25840050-25840072 CAGGGGTTAGGGATGCAGGAGGG - Intronic
1124157815 15:27243387-27243409 CAGGGGATGGGGAAGAAAGAAGG + Intronic
1124561042 15:30773869-30773891 CTGCGAGTGGGGATGGAAGAAGG - Intergenic
1124669488 15:31625190-31625212 CTGCGAGTGGGGATGGAAGAAGG + Intronic
1124901325 15:33825649-33825671 CTGGGGATGGTGACTGAAGAAGG + Exonic
1125588380 15:40838514-40838536 CTGGGGCTAAAGATGCAAGATGG + Intergenic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127595311 15:60476262-60476284 CTGGGGATGGGGGGGTAAGAAGG - Intronic
1127677648 15:61258088-61258110 TTGGGGAGAGGGATGGAAGTGGG + Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128738899 15:70070105-70070127 TTGGGGTTAGGGATGCAAGAGGG - Intronic
1128783210 15:70376466-70376488 AGGGAGAAAGGGATGGAAGAGGG + Intergenic
1128886255 15:71290974-71290996 CTGGGGAGTGGGATGGAATTTGG - Intronic
1129332048 15:74832719-74832741 ATGGGGAGGGGGAAGGAAGAAGG - Intergenic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1130194910 15:81770644-81770666 CTGGGGCTAGGGATGAGAGGGGG + Intergenic
1130571321 15:85046704-85046726 CAAGGGATAGGGAGGGTAGAGGG + Intronic
1130838102 15:87671679-87671701 ATGGTGATGAGGATGGAAGATGG - Intergenic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131314237 15:91318814-91318836 ATGGGGAGAGGGACGGGAGAGGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132448341 15:101950362-101950384 TTGGGGATGGGGATGGAAGTGGG + Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133398796 16:5469665-5469687 CAGGGGCTGGGGATGGAGGAAGG - Intergenic
1133499165 16:6348924-6348946 CTGGGGATAGAGATGGACAGAGG + Intronic
1133688478 16:8189785-8189807 CTGTGGAGAGGGATGGAGGGTGG - Intergenic
1133857474 16:9563307-9563329 CTGGGGCTGGGGATGGGAAAAGG + Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134855834 16:17518296-17518318 TTGGGGAAAGGGTGGGAAGAGGG - Intergenic
1135164773 16:20129560-20129582 GGGGGGATGGGGAGGGAAGAAGG - Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135288405 16:21213755-21213777 TTGGGGATAGAGATGGTAAAAGG + Intronic
1135866239 16:26105029-26105051 CGGGGGATAAGGCTTGAAGAAGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136247923 16:28985812-28985834 TTGGGGATGGGGCTGGAAGATGG - Intronic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1138679740 16:58676165-58676187 CTGGGGGGAAGGATGGAACAGGG - Intronic
1138966399 16:62089402-62089424 CTGGAGATAGGCATAGAAGAAGG + Intergenic
1139845266 16:69916557-69916579 CTGGACATAGGAATGGAAAATGG + Intronic
1139917320 16:70436895-70436917 CTGGGGAGAGGGGTGGGAAATGG - Intronic
1140352869 16:74279515-74279537 TTGGGGGAAGGGATGGAAGTGGG + Intergenic
1140701558 16:77586267-77586289 CTGGGGTGAGCCATGGAAGAGGG + Intergenic
1140894947 16:79316746-79316768 CTGGAGATAGGGACAGAGGAAGG + Intergenic
1141344307 16:83231175-83231197 GTGAGGATAGGGGTGGAGGATGG - Intronic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141560228 16:84862924-84862946 GTGGGGATGGGGATGGAAGAAGG + Intronic
1141604383 16:85144574-85144596 CTGGGGGTAGGGAAGGGAGGAGG + Intergenic
1141806590 16:86345819-86345841 CTGGGGCTACGGCTGGAAGCTGG - Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1142250012 16:88987037-88987059 CTGGGGAGAGGGAGGGACGGAGG - Intergenic
1142314255 16:89333519-89333541 CTGGGGAGAGGGAGGGACGGAGG - Intronic
1142323376 16:89399497-89399519 CTGGGGAGAGGGAGGGACGGAGG + Intronic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142807951 17:2381326-2381348 CAGGGGGTAGGGATGGGACAGGG - Intergenic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143171091 17:4930857-4930879 TTGGTGATGGGGATGAAAGACGG + Intergenic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143539595 17:7561311-7561333 CTGGAGATAGTGATGGAAACTGG - Exonic
1143565285 17:7717194-7717216 GCGGGGAAAGGGAGGGAAGACGG - Intergenic
1143727635 17:8860420-8860442 CTGGGGATGGGGATGGATTCGGG - Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1144760143 17:17702501-17702523 CTGGGGACAAGAATGGGAGAAGG - Intronic
1144767889 17:17742816-17742838 CTGGGGACAGGGATGGCCGAGGG - Intronic
1146029975 17:29357722-29357744 CTGGGGCTAGGGTTGGGAGCAGG - Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146490654 17:33279218-33279240 CTGAGGAGAGGCCTGGAAGATGG - Intronic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146646562 17:34580657-34580679 CTGGGGATTGCGTTGGAAGTCGG + Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1147141788 17:38464571-38464593 CTGGGGAGAGGGAGGAAGGAGGG + Intronic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147192982 17:38748123-38748145 CTGGGGATTGGGATGGGGGCCGG - Intronic
1147288785 17:39424739-39424761 CTGGGGATAGGAAAGAAAAAGGG + Intronic
1147316456 17:39623188-39623210 ATGGGCAAAGGGATGGACGATGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147704116 17:42414260-42414282 AGAGGGATAGGCATGGAAGAGGG + Intronic
1148082415 17:44974863-44974885 TTGGGGATGGGGATGGAGTAGGG + Intergenic
1148190052 17:45672125-45672147 CTGGAGCTGGGGTTGGAAGAGGG - Intergenic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148524326 17:48316057-48316079 AGGGGGATAGGAGTGGAAGAGGG - Intronic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1148701843 17:49592265-49592287 TTGGGGTTGGGGGTGGAAGAAGG - Intergenic
1148770625 17:50064054-50064076 CTGGGGATAGGGACGGAGGTGGG - Intronic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150468916 17:65418997-65419019 CTGGAGATAGTGATTGAAGCTGG - Intergenic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1151247252 17:72804394-72804416 GTGGGGAGTGGGAGGGAAGAGGG - Intronic
1151285668 17:73109238-73109260 CAGGGGATGGGGATGGGAGGTGG - Intergenic
1151745966 17:76011936-76011958 TGGGGGATAGGGCTGGAAGAGGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152863508 17:82709345-82709367 CAGGGGACAGGGGTGGAACACGG - Intergenic
1154972521 18:21424812-21424834 CTGAGGAAAGGGATGAAACAGGG - Intronic
1155032783 18:21998760-21998782 CTGGGTGTAGGGATGGCAGGGGG + Intergenic
1155526508 18:26721314-26721336 CTGGGGATGGGGATGGAGGCAGG + Intergenic
1155758336 18:29530762-29530784 ATGGGGAAAGGGAGGTAAGAAGG + Intergenic
1155776628 18:29771196-29771218 AAGGGGATAGGGATGGTAGAAGG + Intergenic
1156444162 18:37222427-37222449 AAGGGGGTAGGAATGGAAGATGG + Exonic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1156753119 18:40485322-40485344 ATGGGGGTAGGGATGGAGGTGGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157556083 18:48613708-48613730 CTGGGGAAAGGGATGCATGCAGG - Intronic
1157595338 18:48860658-48860680 CTGGGGAAAAGGATGGGAGTGGG + Exonic
1157681177 18:49608214-49608236 CTGGGGCTAGGGCTGGGTGAGGG + Intergenic
1157710551 18:49847076-49847098 CTGGGGATGGAGATGGGAGCGGG + Intronic
1158185402 18:54765709-54765731 ATGGGGAAAGGAAAGGAAGAAGG - Intronic
1158579198 18:58666928-58666950 CTGGGGATACTGATGGGAAAGGG - Intergenic
1158869368 18:61669780-61669802 CTGGACCTAGGGATGGAAGGAGG - Intergenic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159605332 18:70468885-70468907 ATTGGAATAGGGATGGGAGAGGG + Intergenic
1159750598 18:72296414-72296436 CTGGGGTTAGGGATGGGAAGAGG - Intergenic
1160068618 18:75604110-75604132 CTGGGGTTGGGGGTGGCAGAAGG + Intergenic
1160326240 18:77951282-77951304 CTGGGGTTATGGATGGAACTTGG + Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160636926 19:82191-82213 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1160709562 19:544806-544828 ATGGGTAGAGGGATGGATGATGG - Intronic
1160726243 19:619012-619034 CAGGCGATAGGGCTGGATGACGG + Exonic
1160784637 19:893963-893985 GTGGGAATAGGGTTGGAAGTAGG - Intergenic
1161459226 19:4386677-4386699 CTGGGGAAAGGCATGGAAGCTGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161872113 19:6878240-6878262 CTGGGGATGGGGATGGGATGAGG - Intergenic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162934671 19:13975814-13975836 GTGGGGATAGGGCTGGCAAAGGG + Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163038402 19:14584930-14584952 TTGGGGACAGGGATGGATGTGGG - Intronic
1163039098 19:14589191-14589213 TTGGGGACAGGGATGGATGTGGG - Intronic
1163242946 19:16075645-16075667 CTGGGGACAGGGATGGGCGGAGG + Intronic
1163263044 19:16202927-16202949 CTGCTGATAGGAATGGAAAATGG - Intronic
1163376156 19:16931736-16931758 CTGGGGATGGGGAAGCCAGATGG - Intronic
1164803998 19:31102171-31102193 CTGGGGATTGACATGGGAGAGGG + Intergenic
1164840725 19:31390311-31390333 ATGGGGAGAGGGAAGGAACAGGG + Intergenic
1165159640 19:33808466-33808488 CAGGGGATGGGGGTGGCAGATGG + Intronic
1166002034 19:39883249-39883271 ATGGGACTAGGGATGGAGGATGG - Intronic
1166004818 19:39899500-39899522 ATGGGACTAGGGATGGAGGATGG - Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166206590 19:41273765-41273787 GTGGAGACAGGGATTGAAGAAGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166726943 19:45034327-45034349 CTGGGGATGGGGGTGGAAAGGGG - Intronic
1166855576 19:45781363-45781385 CTGGGGCCAGGGCTGGAAGGAGG - Intronic
1167311591 19:48740434-48740456 CTGGGTCCTGGGATGGAAGATGG + Intronic
1167331991 19:48861693-48861715 CTGGGGAGAGAGATGGGAGGAGG + Intronic
1167339102 19:48904295-48904317 GTGGGGATGGGGATGGGAGCAGG + Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167651415 19:50731805-50731827 CTGGCGAGGGGGATGGGAGAAGG - Intergenic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168483801 19:56743558-56743580 CTGGGGACAGGAATCAAAGAAGG - Intergenic
925106897 2:1299461-1299483 GTGGAGACAGGGATGGAAGCTGG - Intronic
925375461 2:3380642-3380664 CTTGGGATTGGGGTGGGAGAGGG + Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925974468 2:9132038-9132060 ATGGGGAGGGGGATGAAAGAAGG + Intergenic
926425597 2:12736158-12736180 AAGGGGATAGGAATGGAAAAGGG + Intronic
926983201 2:18593535-18593557 GTGGGGAGAGGGAGGAAAGAAGG - Intergenic
927449464 2:23194474-23194496 TTGGCGATAGGGTTGGAAAATGG + Intergenic
927659955 2:24984719-24984741 TCAGGGATAGTGATGGAAGAGGG + Intergenic
927996754 2:27492383-27492405 CTGGGGATAGGGATGGGGTCAGG - Exonic
928161826 2:28934262-28934284 CTGGGAATCGGGGTGGAAGGAGG + Intronic
929097258 2:38275352-38275374 CTGAGGCAAGGGATGGGAGATGG - Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932702170 2:73999651-73999673 CTGGGGGTTGTGATAGAAGATGG + Intronic
933044805 2:77521942-77521964 GGGGGGATAGGGATGGGGGAGGG + Intronic
933580051 2:84115915-84115937 TTGGGGGTAGGGATTGGAGATGG - Intergenic
933723509 2:85413079-85413101 CTGGGGCTGGGGATGGAAATAGG - Intronic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
933749563 2:85594436-85594458 TTGGGCAAAGGCATGGAAGAAGG + Intergenic
934309431 2:91850144-91850166 CGTGGGATAGGGAAGGATGAGGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934992363 2:98930501-98930523 GTGGGGATGGGGATGGAGTAGGG - Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935268812 2:101416190-101416212 CTGGGGAGGGGGGTGGAAGAAGG + Intronic
935381971 2:102462043-102462065 CAGGAGTTAGGGATGGAGGAGGG + Intergenic
935475011 2:103508627-103508649 CTGGGGACAATGATGGCAGATGG - Intergenic
936112442 2:109676162-109676184 ATGGGTATGGGGCTGGAAGAGGG - Intergenic
936564550 2:113572850-113572872 TTGGGGATGGGGATGGAAGTGGG + Intergenic
936754063 2:115683327-115683349 CTCGGGATTAGGATGGAAGAAGG + Intronic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937094437 2:119226221-119226243 CTGGGGCAAGGGAAGGAAGCAGG + Intronic
937889872 2:126930751-126930773 CTGGGGACTGGGATGCCAGACGG + Intergenic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
938026468 2:127953385-127953407 CTGGGAACAGGGATGGAATCGGG - Intronic
938406937 2:131038033-131038055 CTGGGGCTTGGGATGGGAGCAGG + Intronic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939925810 2:148172466-148172488 CTGGGGTTGGGGAAGGCAGAGGG + Intronic
940349358 2:152664778-152664800 CTGAGGATTGGGTTGGAAGCAGG - Intronic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
941080880 2:161059275-161059297 CTGGAGGTTGGGATGGTAGATGG - Intergenic
942505199 2:176634550-176634572 CTGGGGGTGGGGATGGTTGAAGG + Intergenic
942604876 2:177679968-177679990 CTGGGGAGAGGGCTGCAGGAAGG + Intronic
943725400 2:191246324-191246346 TTGGGGAGAGGGTTGGGAGAGGG + Intronic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944073280 2:195697058-195697080 CTGAGGACAGAGGTGGAAGAGGG + Intronic
944315505 2:198281230-198281252 CTGGGGAGAGGGAGGAAATAGGG - Intronic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
944822046 2:203441026-203441048 CTGGGGTTGGGGGTGGAGGAGGG + Exonic
944863722 2:203840251-203840273 CAAGGGATAAGGATGAAAGAAGG + Intergenic
945033393 2:205685173-205685195 CTGGGGATTGGGATGGGAGGGGG - Intronic
945112797 2:206378854-206378876 CTGGGACTAGAGATGGAATAGGG + Intergenic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945915052 2:215694806-215694828 CTGGGGATGGGAGGGGAAGAGGG + Intergenic
946101193 2:217325610-217325632 CTGGTGATAGGAATGGAAAAAGG + Intronic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
946226997 2:218269540-218269562 TTGGGGAGAGGGTTAGAAGATGG + Intronic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946736033 2:222755481-222755503 CTGGGAATGGGCATGAAAGAGGG + Intergenic
947275672 2:228389465-228389487 TTGGGAATCGGGAGGGAAGAAGG - Intergenic
947342220 2:229152086-229152108 GTGGGGAGTGGGATGGAAAATGG - Intronic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
948047873 2:234957637-234957659 CTGGGGATGGGCCTGGAACATGG - Intronic
948109165 2:235440575-235440597 CTGGGAGGAGGGATGGAGGAAGG - Intergenic
948314568 2:237017452-237017474 CTTGGGATATGGTTGTAAGATGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
1168955892 20:1834148-1834170 CTGGGGATATTGCTGGAAAAGGG - Intergenic
1169004755 20:2197197-2197219 ATGAGGTTGGGGATGGAAGAGGG - Intergenic
1169237688 20:3944773-3944795 ATGGGGGTAGGGATTGAAGAAGG - Intronic
1169546721 20:6657886-6657908 ATGGAGATAGGGAAGAAAGAAGG + Intergenic
1169595233 20:7190923-7190945 GTGAGTATAGGGATGGGAGATGG + Intergenic
1169700736 20:8443845-8443867 ATTGGGGTAGGGGTGGAAGAAGG - Intronic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170931573 20:20773523-20773545 CAGGGGATGGGGATGAGAGATGG - Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171472392 20:25382635-25382657 TTGGAGAGAGGCATGGAAGATGG - Intronic
1172656645 20:36542031-36542053 CAGGGTGTAGGGATGGGAGATGG - Intronic
1172659904 20:36560600-36560622 CTGGGTTGAGGGATGGGAGAAGG - Intergenic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1173118027 20:40264562-40264584 CTGGGGATTGGGATGGGACAGGG + Intergenic
1173857561 20:46260498-46260520 ACGGGGAAAGGGATGGAAGAAGG - Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174131516 20:48346826-48346848 GTGGGGAGAGGAATGGGAGATGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175451791 20:59075772-59075794 GTGGGAATAGGGATGGAGGGAGG + Intergenic
1175754877 20:61523130-61523152 CTAGGGAGAGGGATGGAGGATGG - Intronic
1175791142 20:61740602-61740624 CTGGAGAGAGGCCTGGAAGATGG - Intronic
1176669783 21:9722473-9722495 CAGGGGAGAGGGATGGGAGAAGG - Intergenic
1177844865 21:26277685-26277707 CTGGGGAGAGGAATGGAATTTGG + Intergenic
1177944914 21:27455938-27455960 TGGGGGAGAGGGAAGGAAGAAGG - Intergenic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178570358 21:33730214-33730236 CAGGGTAAAGGGATAGAAGAGGG - Intronic
1178794931 21:35735119-35735141 CTGGGGACAGGGATGGGATCTGG + Intronic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1180085999 21:45508171-45508193 CTGGGGAGATGGATGGATGGTGG + Intronic
1180117309 21:45718570-45718592 CGGGGGAAGGGGATGGAAGTAGG + Intronic
1181519811 22:23438936-23438958 CTGCTGATAGGAATGGAAAATGG - Intergenic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1181612126 22:24022683-24022705 CTGCTGATAGGAATGGAAAATGG - Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182074608 22:27487376-27487398 CTGGGGAGAATGATTGAAGAGGG - Intergenic
1182138446 22:27930192-27930214 GTCGAGATAGGAATGGAAGAGGG - Intergenic
1182458828 22:30470124-30470146 CTGAGAACAGGGATGGAAGGAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182812725 22:33131371-33131393 CTGGGAATAGGGATAAAGGAAGG - Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183456406 22:37925524-37925546 ATGGGGATGGGGGTGGGAGAAGG + Intronic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185419997 22:50729837-50729859 GTGGGGATAGGGATGGGAATGGG + Intergenic
949152069 3:781362-781384 CAGGGGAGAAGGATGGGAGAAGG - Intergenic
949160758 3:879121-879143 CTAAGGATAGGGATGGAGAAAGG + Intergenic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949681960 3:6524265-6524287 GTGGAGGTAGGGATGGAAGTAGG + Intergenic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950451062 3:13066067-13066089 CAGGGGCTGGGGATGCAAGATGG + Intronic
950469608 3:13176412-13176434 CTAGGGGTAAGGGTGGAAGAAGG - Intergenic
950598311 3:14006223-14006245 CTAGGATTAGGGATGAAAGAGGG - Intronic
950625735 3:14245345-14245367 CTGGGGACGGGGGTGGAGGAGGG - Intergenic
950629101 3:14269777-14269799 CTAGGGATAGGGTTGGGGGAAGG - Intergenic
951154419 3:19332260-19332282 GTAGGGTTAGGGATGGTAGAGGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
951526239 3:23655737-23655759 CTAGAAACAGGGATGGAAGAAGG - Intergenic
951686646 3:25351732-25351754 GTGAGGATGGGGATGGAACAAGG - Intronic
953020338 3:39108989-39109011 CAGGGGATAGGGAAGGGAGCAGG + Intronic
953038750 3:39236558-39236580 CTGGGGACAGGGATGGGAGGAGG - Intergenic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
954291417 3:49652028-49652050 CTGGGGGCTGGGGTGGAAGAGGG - Exonic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954472190 3:50707604-50707626 GTGGGGATGGGGATGTCAGATGG + Intronic
954696889 3:52432332-52432354 CTTGGGAGAGTGATGCAAGAGGG + Intergenic
954749152 3:52804010-52804032 GTGGGGATAGGGATGGAGGCCGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955189107 3:56743860-56743882 CTGGTGATAGGGATGCAAGTTGG - Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956411760 3:68986653-68986675 CTGGGGATGTGGATGGATGGGGG - Intronic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
956861299 3:73326656-73326678 CTGGGGAGGGGGATGGCAGAGGG - Intergenic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
957407913 3:79795795-79795817 CGAGGGACAGGGATGAAAGATGG + Intergenic
957458389 3:80483782-80483804 CTGGGGATGGGGGTAGAAGGTGG + Intergenic
957955953 3:87187183-87187205 TTGGTGTTGGGGATGGAAGAGGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958057543 3:88431451-88431473 ATGGGGAAAGGGTTGGAAGGGGG + Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
959087599 3:101868105-101868127 GAGGGGAGAGGGAGGGAAGAAGG - Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
960382263 3:116977964-116977986 CTGGGAACAGGTGTGGAAGAAGG + Intronic
961197573 3:125015582-125015604 CTATTGATGGGGATGGAAGAGGG + Intronic
961427715 3:126861211-126861233 CTGTGGACAGGGATGCAAGGAGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
962089830 3:132231307-132231329 CTGGGGAAAGCGAAGGAATAGGG - Intronic
962249052 3:133823756-133823778 GTGGGGCTGGGGATGGAATATGG + Intronic
962406787 3:135107314-135107336 CTCTGGATAGGGATGTGAGAAGG + Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
962991109 3:140578211-140578233 GTGGGGAGAGGGCAGGAAGATGG - Intergenic
963430287 3:145192643-145192665 CTGGTGGTAGAGATGGGAGAGGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963637020 3:147810906-147810928 CAGGGGAAAGGGGTGGGAGAAGG + Intergenic
963758491 3:149259978-149260000 CTGGGGATGGGGATGCCAGATGG - Intergenic
965528562 3:169747421-169747443 ATGGGGATAGGGGTAAAAGAAGG + Intergenic
966459054 3:180154634-180154656 CTGGGGCTAGGACTGGATGAGGG + Intergenic
967459081 3:189724472-189724494 CCGGGGAAAGGGTGGGAAGAGGG - Intronic
967666638 3:192180534-192180556 CTTGGGATAAGGATGAAAGTAGG + Intronic
967727395 3:192874503-192874525 GTGGGGATAGGGCTGGAATTGGG - Intronic
967890694 3:194362373-194362395 CTGTGGATAAGCATGGAACAAGG - Intronic
968284864 3:197502569-197502591 CTGGGGCTAGGCCTGGGAGAGGG - Intergenic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
970317645 4:14845041-14845063 GTGGGGATGGGGATGGGAGTGGG + Intergenic
970317656 4:14845065-14845087 ATGGGGATGGGGATGGGAGTGGG + Intergenic
970317667 4:14845089-14845111 ATGGGGATGGGGATGGGAGTGGG + Intergenic
970751369 4:19367152-19367174 CTGGGGGTGGGTGTGGAAGAGGG + Intergenic
972914152 4:43855232-43855254 CTGGAGATTGGGATGGGAGCAGG - Intergenic
974596287 4:64017381-64017403 AGGGGGATAGAGACGGAAGATGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977579613 4:98710741-98710763 ATGGGGCTAGGGATAGAGGATGG + Intergenic
978823813 4:112996255-112996277 CTGGGAATAGGGATGGGAGCAGG + Intronic
980470970 4:133250965-133250987 ATGGGGATAGGGAAGAGAGATGG + Intergenic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981551761 4:145948646-145948668 CTGGGGATAGAGCCTGAAGAAGG - Intergenic
982425368 4:155252301-155252323 CTGGTGATAGAAATGGAAAACGG + Intergenic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
983544384 4:168947533-168947555 TTGGGGAGAAGGATGGGAGAGGG - Intronic
983650015 4:170027694-170027716 CTCGGGAAACGGATGGAAGCAGG + Intronic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985404999 4:189629047-189629069 CAGGGGAGAGGGATGGGGGAAGG + Intergenic
985698387 5:1356137-1356159 CTGGGCATTGGGATGAAACATGG + Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
987259595 5:16189916-16189938 CTGGGGAGAAGGTTGGGAGAAGG + Intergenic
987288671 5:16487327-16487349 CTGGCGAGAGGGAGGGGAGATGG - Intronic
989973639 5:50555403-50555425 ATGGGGATAGAGAAGGAAGTGGG - Intergenic
990471392 5:56119418-56119440 CAGGGCTTAGGGATGGGAGAGGG + Intronic
991041436 5:62179990-62180012 CTGGGGATGAGGCTGGAATATGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
994084453 5:95743317-95743339 CTGGGGATGGGGGTGTAAGTAGG + Intronic
994868125 5:105305537-105305559 ATAGGGATAGGGAGGGAGGAGGG - Intergenic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
997236173 5:132273054-132273076 CTGAGGAGAGGGGTGGAAGCCGG - Exonic
997266130 5:132496380-132496402 CTGGGGGTAGGGGTGGAAGTGGG - Intergenic
997322224 5:132987991-132988013 CTCGGGAGAGAGATGGGAGAAGG - Intergenic
997356697 5:133267152-133267174 CTGGGGATAGGGGAAGAAAAGGG + Intronic
997902254 5:137777805-137777827 GAGGAGAGAGGGATGGAAGAAGG - Intergenic
998594577 5:143515559-143515581 ATGGGGAAAGGAAGGGAAGAAGG - Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
999061490 5:148640304-148640326 CTGGAGCTAGGGATTGGAGAAGG - Intronic
999103332 5:149046200-149046222 CTGGGGTTTGGTATGGCAGAAGG - Intronic
999160382 5:149491242-149491264 CTGGGGATTGGGGTGGCAGGGGG - Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000359800 5:160436358-160436380 CTGGGGAATGGGGTGGAACAGGG + Intergenic
1000590086 5:163147276-163147298 CTGGGGGTAGGGATGGCTGTAGG + Intergenic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001688282 5:173612515-173612537 CTGGGGTTACGGATGGGAGGAGG - Intronic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1001926087 5:175638301-175638323 CTGGGCATAGGGATGGCGCATGG - Intergenic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002418117 5:179131495-179131517 CTGGGGATGGGGATGAATGTGGG + Intronic
1002518526 5:179776703-179776725 CCGGGGACAGGGGTGGGAGACGG - Exonic
1002641622 5:180633222-180633244 CAGGAGAGAGGGATAGAAGAAGG - Intronic
1002679184 5:180948097-180948119 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002685057 5:181003598-181003620 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1003512601 6:6793889-6793911 GTGGGGAGAGGTATGGGAGAGGG - Intergenic
1003783424 6:9455919-9455941 ATGTAGAGAGGGATGGAAGAGGG + Intergenic
1004058885 6:12171153-12171175 CTTGGGAGAGGGAGGGATGAGGG - Intergenic
1004076186 6:12346155-12346177 CCTGGGAGAGGGATGGAGGAAGG + Intergenic
1004201369 6:13551194-13551216 CTGGGGAGAGGGCGGGAATAAGG + Intergenic
1004429841 6:15533413-15533435 CTGGGGTTAGGGTTTGAAAAGGG + Intronic
1005436094 6:25813717-25813739 CTGGGTAGAGGGTGGGAAGAGGG - Intronic
1005877913 6:30028127-30028149 TCGGGGAAAGGGAGGGAAGAAGG + Intergenic
1006061655 6:31424994-31425016 CAGGGGTTAGGCATGGAAGCGGG - Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1006510297 6:34517729-34517751 GAGGGGACAGGGAGGGAAGATGG - Intronic
1006694538 6:35920532-35920554 CAGGAGAGAGGGATGGATGAAGG + Intronic
1007172868 6:39876869-39876891 CTGGGGACAGGAAGGAAAGAGGG + Intronic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007498019 6:42274950-42274972 CTGGGGATGGGGGTGGAAGGTGG - Intronic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007599473 6:43072864-43072886 TTGGGGAGAGTGATGGTAGAAGG + Exonic
1007623872 6:43231405-43231427 CTGGAGTTAGGGAAGTAAGAGGG - Intergenic
1008394839 6:50994325-50994347 CTAGGGGTAGGGAAGGAGGAAGG + Intergenic
1009800161 6:68527381-68527403 ATGGGGAGAGGAATGGAGGAAGG - Intergenic
1010676096 6:78745436-78745458 CTGGGGGCAGGGATGGCAGGTGG + Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011569497 6:88719165-88719187 CTAGGCAGAGGGATTGAAGAAGG - Intronic
1012027575 6:94017095-94017117 CTGGGGATTGGAGTGGAGGATGG - Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013360585 6:109390586-109390608 CAGGAGTTAGGGATGGCAGAGGG + Intronic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1015399162 6:132768810-132768832 GTGGGGATAGGGACGGTAAAGGG - Intergenic
1015440540 6:133241760-133241782 CTGGGGCGGGGGTTGGAAGAAGG - Intronic
1015462288 6:133505213-133505235 TTGGGGATAGGGATGGGAATAGG - Intronic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016234455 6:141846238-141846260 GTGTGGATAGGGATGCAATATGG + Intergenic
1017539036 6:155380872-155380894 GTGGGGTGAGGGTTGGAAGAGGG - Intergenic
1017616323 6:156250413-156250435 CTAGGGAAAGGGAAGGAAGGAGG - Intergenic
1018123562 6:160660219-160660241 ATGCTGATAGGGAGGGAAGAGGG - Intronic
1018136353 6:160781640-160781662 ATGCTGATAGGGAGGGAAGAGGG + Intergenic
1018575431 6:165255038-165255060 CTGGTGATAGAGATAGGAGAGGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018657392 6:166051526-166051548 CTGGGGTTAGGGATGGTGGGGGG - Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1019324643 7:432152-432174 CTGGGTTCAGGGCTGGAAGATGG + Intergenic
1019591449 7:1837347-1837369 CTGCTGATAGGAATGGAAAATGG + Intronic
1019615334 7:1956861-1956883 TTGGGGAAAGGGCTGGAAGCTGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019880872 7:3859666-3859688 CTGGGGATGGTAATGGAAGTTGG - Intronic
1020253396 7:6486920-6486942 TTGGGCATAGGGATGCTAGATGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021245174 7:18252912-18252934 CTGGGGTGGAGGATGGAAGAGGG - Intronic
1021518996 7:21519802-21519824 CTGGACATAGTAATGGAAGAAGG + Intergenic
1021550393 7:21865498-21865520 CAGGGGATGGGGAAGGAAAAAGG + Intronic
1021847674 7:24778653-24778675 ATGGGCATAAGGATGGAAGCTGG - Intergenic
1023921890 7:44636252-44636274 CTGGGGGAAGGGATGTCAGATGG + Intronic
1025018618 7:55463614-55463636 CTGGGGATGGGGATGCCAGGTGG + Intronic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1026142831 7:67720956-67720978 CTTGGGACAGGGTAGGAAGAGGG + Intergenic
1026539819 7:71269817-71269839 CTGGGGGAGGTGATGGAAGACGG + Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027933188 7:84566809-84566831 CTGGGGACAGGGTTGGTAGATGG - Intergenic
1028853490 7:95563718-95563740 CTGGGGCTAGGGGTGGGAGCAGG + Intergenic
1028861141 7:95651932-95651954 CAGGGGTTAGGGATGAAGGATGG - Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029490988 7:100869801-100869823 CTGGGGAGGGGGATGGGAGGGGG + Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030259752 7:107550651-107550673 CAGGTGATGGGGATGGATGAAGG - Intronic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1031472070 7:122177603-122177625 CAGGGGCCAGGGATGGGAGAAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031574107 7:123394830-123394852 CTGTGGATAACAATGGAAGATGG + Intergenic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032414603 7:131726328-131726350 ATGGGGATAGGCTTGGAAGAGGG + Intergenic
1032414710 7:131727253-131727275 GTGGGGATAGGATTGGAAGAAGG - Intergenic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035092427 7:156325271-156325293 TTGGAGATAGGGATGGAGGCTGG + Intergenic
1035289949 7:157831465-157831487 CTGGGGCTGGGGCTGGGAGACGG + Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035482144 7:159195777-159195799 CTGGGGAGAGGGAGGGATGGGGG + Intergenic
1035532566 8:364860-364882 CTGAGCACAGGGATGAAAGAGGG - Intergenic
1035733679 8:1872049-1872071 GAGGGGAGAGGGATGGAAGAAGG + Intronic
1035783137 8:2244381-2244403 GTGGTGATAGGGGTGGGAGAGGG + Intergenic
1035808988 8:2475205-2475227 GTGGTGATAGGGGTGGGAGAGGG - Intergenic
1036614906 8:10380720-10380742 CTGGAGAGATGGATGGAAGGAGG + Intronic
1036655827 8:10676709-10676731 ATGGGGCTAGGGATGGCAGGAGG - Intronic
1037817034 8:22117806-22117828 CTGGGCTTAGGGCTGCAAGATGG + Intronic
1038480758 8:27900274-27900296 CTAGGCACAGGGATGGGAGAAGG + Intronic
1038550097 8:28460104-28460126 TGGGGGATAGTGATGGGAGAGGG - Intronic
1039081617 8:33739359-33739381 GTGGGGAAAGGGAAGGAAGCAGG + Intergenic
1039595917 8:38789614-38789636 GTGGGGATAGGGAAGGCTGAAGG + Intronic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040063732 8:43127612-43127634 CTGGGGAAAGGGATGCCAGAGGG + Intergenic
1040428015 8:47308640-47308662 GTGGGGATGGGGGTGGGAGAGGG + Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1041038239 8:53817680-53817702 CAGGGGGTAGGGATGGTAGTAGG + Intronic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041524068 8:58786430-58786452 CTGGAAATAGGGAAGGTAGAGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1042079996 8:65041077-65041099 CTGGTATTAGGGATAGAAGAGGG + Intergenic
1042314543 8:67411603-67411625 CTGGGGATGGTGATGGAGGTGGG + Intergenic
1042552018 8:70002635-70002657 CTGGGGCTAAGGTTGGGAGAGGG + Intergenic
1042976127 8:74471671-74471693 CTGGGGATGGGGATGGAGAAAGG - Intronic
1043383280 8:79725123-79725145 CTCCAGATAGGGATGGAACAGGG + Intergenic
1043614762 8:82112310-82112332 CTAGGGACAGGGAGGGAAGGAGG - Intergenic
1043881168 8:85544708-85544730 GTGGGGGAAGGGATGGAAGTGGG + Intergenic
1044329335 8:90898277-90898299 GTGGTGGTAGTGATGGAAGAGGG - Intronic
1044378085 8:91499953-91499975 CTGGGGACAAGGATGGCAGTGGG - Intergenic
1044928212 8:97227174-97227196 CTGGGGATGGAGATGGATGATGG - Intergenic
1046821757 8:118641521-118641543 CTAGGGTTGGGGATGGAAGCAGG + Intergenic
1047251327 8:123183580-123183602 CTGGGGATCAAAATGGAAGAGGG - Intronic
1047254243 8:123204066-123204088 CCTGGGAAAGGGATGCAAGAAGG + Intronic
1047362859 8:124184854-124184876 TTGGGGATAGGGTGGGAATAGGG - Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047754450 8:127907844-127907866 TTGGGGATTGGGATGGGAGGGGG + Intergenic
1047876738 8:129146762-129146784 CTTGGCATATGGATGGATGATGG + Intergenic
1047904588 8:129459713-129459735 CTGGGGATGGGGCTGGTAGCAGG - Intergenic
1048374510 8:133811147-133811169 CCGGGGAAAGGGCGGGAAGAGGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048959361 8:139563138-139563160 CTGGTGTTAGGGATGGAGGGAGG - Intergenic
1049049486 8:140183242-140183264 CTGGGGATGGGGATGGTTGGTGG + Intronic
1049887870 9:40364-40386 TTGGGGATGGGGATGGAAGTGGG - Intergenic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1050136886 9:2474786-2474808 CTGGGGGTGGGGATGGGAGGTGG + Intergenic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050483153 9:6106850-6106872 CTGGGGCTGGGGATAGCAGAGGG + Intergenic
1050537896 9:6645830-6645852 CTGGGAAGAGGGTAGGAAGAGGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051871153 9:21739032-21739054 CTGGGGAAAGGAATTGGAGAGGG + Intergenic
1052879226 9:33590474-33590496 CTGGGGGTGGGGGTGAAAGATGG + Intergenic
1053179256 9:35954111-35954133 CTGGGGATGGGGATGAAGGGTGG + Intergenic
1053496752 9:38553745-38553767 CTGGGGGTGGGGGTGAAAGATGG - Intronic
1055300669 9:74878425-74878447 CTGGGGATGGGGACATAAGATGG - Intronic
1056075258 9:83031854-83031876 ATGGGGGCAGGGATGGAAGGTGG - Intronic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056516457 9:87355838-87355860 CTGGAAATGGGGATGGGAGAAGG - Intergenic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056798537 9:89675471-89675493 CTGGGCACAGGGATGTAAGCCGG + Intergenic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1057177662 9:93011395-93011417 CTGGGGATGGGGGTGGAAGGAGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057676667 9:97141301-97141323 CTGGGGGTGGGGGTGAAAGATGG - Intergenic
1057799890 9:98184571-98184593 CCAGGGATAGGGATAGAGGACGG - Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058073556 9:100626970-100626992 CTGGGTACAGGGTAGGAAGAGGG - Intergenic
1058656713 9:107228928-107228950 CGGGGGATGGGGGAGGAAGAGGG + Intergenic
1059060890 9:111034775-111034797 ATGGGGATAGGGAGGCAAGGAGG - Intronic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059638819 9:116196230-116196252 TTTGGGAAAGGGATGAAAGAAGG - Intronic
1059712214 9:116879003-116879025 CTGGTGATCTGGATGGCAGAGGG + Intronic
1060160223 9:121355788-121355810 CTGGGGCCAGGGATGTGAGATGG - Intronic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060302444 9:122383258-122383280 CTGGGGATAGGAGTGGAAATAGG + Intronic
1060307234 9:122425060-122425082 CTGGGGCTAGGAGTGGCAGAAGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061000408 9:127899389-127899411 CCGGGGATGGGGATGGATGCGGG - Intronic
1061222326 9:129259303-129259325 ATGGGGATGGGGCTGGGAGAAGG - Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061611668 9:131750717-131750739 CTGGGGCTGGTGGTGGAAGAAGG - Intergenic
1061947435 9:133916564-133916586 CTGGTGATATGGATGGAGAAGGG + Intronic
1062057207 9:134474899-134474921 CAGGGGCTAGGGATGGAGCAGGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1185499479 X:585722-585744 CCGGAGACAGGGATGGAGGAGGG - Intergenic
1185870116 X:3657813-3657835 GTGGGGGTAGGGATGAAAGAAGG + Intronic
1185934009 X:4235286-4235308 TTGGGGAGAAGGATGGAAGCGGG - Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187017896 X:15348643-15348665 CAGGGAAAAGGGATGGCAGAAGG - Intronic
1187361951 X:18636860-18636882 CTGGGAAAGGGGATGGAAGGTGG - Intronic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188040870 X:25369066-25369088 CTGGGGATAGGGATGTCAGGTGG + Intergenic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1188811220 X:34656609-34656631 CCAGGGATGGGGAGGGAAGAGGG + Intronic
1189002162 X:36958312-36958334 CCAGGGATGGGGAGGGAAGAGGG - Intergenic
1189733455 X:44045878-44045900 CGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1189756629 X:44278562-44278584 CCGGGGAGAATGATGGAAGAAGG - Intronic
1189779469 X:44500302-44500324 TTGGTGATAGGAATGGAAAATGG + Intergenic
1189898617 X:45682607-45682629 CTGAGGATAGAGGTGGAGGATGG - Intergenic
1190095243 X:47474555-47474577 CAGGGGTTAGGGATGGCAGTGGG + Intronic
1190186904 X:48243294-48243316 CAGGGGTTAGGGATGGTGGATGG + Intronic
1190191770 X:48282525-48282547 CAGGGGTTAGGGGTGGTAGATGG - Intergenic
1190195050 X:48310082-48310104 CAGGGGTTAGGGATGGTGGATGG - Intergenic
1190202850 X:48378914-48378936 CAGGGGTTAGGGATGGTGGACGG + Intergenic
1190207688 X:48416499-48416521 CAGGGGTTAGGGATGGTGGACGG - Intergenic
1190661482 X:52658305-52658327 CAGGGGTTAGGGATGGTGGATGG - Intronic
1190669126 X:52723572-52723594 CAGGGGTTAGGGATGGCGGATGG - Intergenic
1190670291 X:52734832-52734854 CAGGGGTTAGGGATGGCGGATGG + Intergenic
1191671801 X:63755106-63755128 CGGGGGATGGGGAGAGAAGAGGG - Exonic
1191851239 X:65587879-65587901 CAGGGGATAGAGATTGGAGAAGG - Intergenic
1192229372 X:69254617-69254639 CTGGGGGTGGGGAAGGGAGAAGG + Intergenic
1193793211 X:85841459-85841481 CTGGAGACAGGGATGTCAGATGG - Intergenic
1193865429 X:86725494-86725516 CTGGGGACTGGGATGCCAGATGG + Intronic
1194668907 X:96706524-96706546 TTGGGGATCTGGATGGGAGAAGG + Intronic
1195070358 X:101273249-101273271 CTGGAGAATGGGTTGGAAGAAGG - Intronic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195580907 X:106501509-106501531 GTGGGGCTAGGAATGGGAGAGGG + Intergenic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196342772 X:114615106-114615128 AAGAGGATAGGGATGGAATAAGG + Intronic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198654206 X:138895982-138896004 CAGAGGTTGGGGATGGAAGAAGG + Intronic
1198706156 X:139450693-139450715 CAGGGGACAGGGGCGGAAGATGG + Intergenic
1198993133 X:142539467-142539489 CCAGGGATAGGGCTGGCAGATGG - Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199894792 X:152118767-152118789 GTGGGGATGGGGATGGAAATGGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic