ID: 955887037

View in Genome Browser
Species Human (GRCh38)
Location 3:63611398-63611420
Sequence TATTACCAAAAGCAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955887033_955887037 11 Left 955887033 3:63611364-63611386 CCGAAACTTGGCTCTGCAAAGAA 0: 1
1: 0
2: 1
3: 17
4: 229
Right 955887037 3:63611398-63611420 TATTACCAAAAGCAGGGGAAAGG 0: 1
1: 0
2: 6
3: 24
4: 295
955887032_955887037 19 Left 955887032 3:63611356-63611378 CCATTTGACCGAAACTTGGCTCT 0: 1
1: 0
2: 0
3: 3
4: 67
Right 955887037 3:63611398-63611420 TATTACCAAAAGCAGGGGAAAGG 0: 1
1: 0
2: 6
3: 24
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955887037 Original CRISPR TATTACCAAAAGCAGGGGAA AGG Intronic
901309679 1:8259390-8259412 TATTCCCAGAAGAAAGGGAATGG - Intergenic
902898431 1:19495824-19495846 TGTTACCAAAAGAAGGAGAAGGG + Intergenic
904855924 1:33498265-33498287 CACTACCAAACCCAGGGGAAAGG - Intergenic
904984908 1:34537439-34537461 TATTACAAAAAGCTGGCAAAAGG + Intergenic
905088475 1:35406535-35406557 TAAAACAAAAAGCCGGGGAAGGG + Intronic
905491609 1:38348656-38348678 TATCACCAAAACCAGGAGAATGG - Intergenic
905954116 1:41977828-41977850 TATTACCATGAGCAGGGTCAGGG - Intronic
907601778 1:55779099-55779121 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
910365073 1:86456423-86456445 ACTTACCAAGGGCAGGGGAAGGG + Exonic
910881520 1:91925963-91925985 GATCACTAAAGGCAGGGGAAAGG - Intergenic
912016908 1:105050180-105050202 TGTTACCAGAAGCTGGGGAGGGG - Intergenic
912254311 1:108043820-108043842 TAATGACAAAAGCAGGGGAAGGG - Intergenic
912811507 1:112798632-112798654 AATTAACAAAAGAAGGGAAATGG - Intergenic
913521800 1:119651669-119651691 TGTTACCAAAAAAAGGGAAAGGG - Intergenic
914460972 1:147884888-147884910 TAGAACAAAAAGCAGGAGAAAGG + Intergenic
915670864 1:157487771-157487793 GATTACCAGAGGCAGGGGAGTGG - Intergenic
917812366 1:178671724-178671746 TATTATCCAAAGCATGGGCAGGG - Intergenic
918358331 1:183728062-183728084 TAGAACAAAAAGCAGGGAAAGGG + Intronic
919657974 1:200215718-200215740 TGTTACTAAAAGAAGGGGAAAGG - Intergenic
923407111 1:233672982-233673004 TATTACCAACTGCAGGGCAAAGG + Intergenic
924200794 1:241656587-241656609 ATTTACCAAAAGCAAGGCAATGG - Intronic
924286481 1:242493235-242493257 TATTCCCAAAATGAGAGGAAAGG + Intronic
924794225 1:247281020-247281042 TATTACAAGAGGAAGGGGAAGGG + Intergenic
1062780136 10:196073-196095 AATTACCTAAAACAGTGGAATGG - Intronic
1063778737 10:9295502-9295524 GATAACCAAAAGAAAGGGAAAGG - Intergenic
1065071232 10:22025817-22025839 TATTACCAAAAAGGGGGAAAAGG - Intergenic
1067142149 10:43667106-43667128 AATGTCCAACAGCAGGGGAATGG - Intergenic
1068450481 10:57179940-57179962 AATAACCAAAAACAGGTGAATGG - Intergenic
1070055858 10:72934091-72934113 AATTAACAAAAGTAAGGGAAAGG + Intergenic
1070459378 10:76649446-76649468 TATTACCAATACCAAGGGATGGG - Intergenic
1070477065 10:76839288-76839310 TAATACCAAAAGCAAGATAAAGG - Intergenic
1072168243 10:92834876-92834898 AATTATAAAAAGCAGGGTAAAGG - Intronic
1075448399 10:122529839-122529861 TATGACCAAAAGCAAGGCACTGG + Intergenic
1076197062 10:128526442-128526464 TTTTCACAGAAGCAGGGGAATGG + Intergenic
1077508566 11:2943442-2943464 GATTTGCACAAGCAGGGGAAAGG - Intergenic
1077892019 11:6425690-6425712 TATTACCAATAAAAGGGGGAAGG - Intergenic
1077896102 11:6454679-6454701 TATTTCTAAGAGCAGAGGAATGG - Intronic
1079614152 11:22470001-22470023 TATTTACAAAAACAGGTGAAAGG + Intergenic
1080210541 11:29780528-29780550 TACTACCAAAAGGTGGGGATGGG + Intergenic
1080566308 11:33512714-33512736 TATTACCTAGAGCAGGGGCCGGG - Intergenic
1082730091 11:56785477-56785499 TTTTGCCAAAAGAAGGGAAAAGG - Intergenic
1084602098 11:70151896-70151918 AATTTCCAAAACCATGGGAAAGG + Intronic
1085501384 11:77028188-77028210 TATTAAGGAAAGTAGGGGAAAGG + Intergenic
1086427687 11:86702843-86702865 TTATTCCAGAAGCAGGGGAAAGG - Intergenic
1087317438 11:96619547-96619569 TGGAACCAAAACCAGGGGAATGG - Intergenic
1090166746 11:124557152-124557174 GATCACAAAAAGCAGAGGAATGG + Intergenic
1090819167 11:130325604-130325626 TATTACTAAAAACAGTGGAAGGG - Intergenic
1091129548 11:133134018-133134040 TATTATCAAAGGCAGCTGAAAGG - Intronic
1091941353 12:4486052-4486074 TTTCAGCTAAAGCAGGGGAAAGG - Intergenic
1092443457 12:8530317-8530339 TATGACCAAAAGAACTGGAAGGG + Intergenic
1094040765 12:26119537-26119559 TATCACGAAATGCAGGGGACTGG + Intergenic
1095355156 12:41263872-41263894 TATTATCAATACAAGGGGAAAGG - Intronic
1098022570 12:66170906-66170928 CATTACCAAAGGCAGAGAAAAGG + Intergenic
1098119886 12:67225174-67225196 AACTACCAAATGCAGGAGAATGG + Intergenic
1098342663 12:69468852-69468874 TACTATGAAAGGCAGGGGAAAGG - Intergenic
1098390692 12:69966866-69966888 TGCTACCAAAAGAAGGGGAAAGG - Intergenic
1100145390 12:91671430-91671452 TATCACAAAAAGCAGGGGAAGGG - Intergenic
1100799102 12:98212771-98212793 TGTTTCCAAAAACAGGGGAATGG - Intergenic
1101495904 12:105253959-105253981 TGTTACCAGAAGAAGGGGGATGG + Intronic
1102018685 12:109666312-109666334 TGTCACCAAAAGAAGGGGACAGG - Intergenic
1103058339 12:117839005-117839027 TATTTACAAAAGCAGGTGGAGGG + Intronic
1103493821 12:121345391-121345413 AATTGACAAAAGTAGGGGAAAGG + Intronic
1106847538 13:33752286-33752308 CATTAGCTCAAGCAGGGGAAGGG + Intergenic
1107141873 13:37007396-37007418 TATTGCCAAAAGAAGTAGAATGG + Intronic
1108780205 13:53821257-53821279 TAATAGCAAAATCAGAGGAAAGG - Intergenic
1109634706 13:65099906-65099928 ACTTACAAAAAGCATGGGAATGG + Intergenic
1110900815 13:80821895-80821917 TTTTAGCAAAAGCATGGAAATGG - Intergenic
1112162763 13:96886309-96886331 GATTACCAAAGGCTGGGGGAAGG + Intergenic
1113925124 13:113937399-113937421 TGTTACCATAACCAAGGGAAAGG - Intergenic
1114693284 14:24605426-24605448 AATTTCCAAAAGCAGGGACAGGG + Intergenic
1115227666 14:31121136-31121158 TATTACCCAAAGCAACGTAAAGG + Intronic
1115421937 14:33204872-33204894 TATTGCAAAAAGTAGGGAAAGGG + Intronic
1115733711 14:36300554-36300576 TACTACTAAAAGCAGGACAAAGG + Intronic
1116826831 14:49681210-49681232 TAATACCACAAGCATGGGACTGG - Intronic
1116979209 14:51150071-51150093 TATTAGTAAAAGCAGGGGTTAGG - Intergenic
1117152355 14:52902442-52902464 TATTAACAACAGAGGGGGAAGGG + Intronic
1119103191 14:71899110-71899132 TTTTAAAAAAATCAGGGGAAGGG - Intergenic
1119126791 14:72134846-72134868 TATGACAAAAAGATGGGGAAAGG - Intronic
1119798137 14:77418044-77418066 AATAACAAAAAGCAGGGGTAGGG - Intronic
1119916157 14:78404060-78404082 GATAACCAAAAGAAAGGGAAGGG + Intronic
1120456013 14:84731459-84731481 TATGTCCAAAGGCAGGTGAAGGG - Intergenic
1122358489 14:101139991-101140013 AATTACTAAAATCAGGAGAAAGG - Intergenic
1125361969 15:38873876-38873898 TATCAGGAAAAGCAGTGGAATGG - Intergenic
1125765974 15:42136584-42136606 AATTTCCATCAGCAGGGGAATGG + Intergenic
1128447913 15:67781074-67781096 TATTCCCAAGAGCTGGGGAGTGG - Intronic
1128589227 15:68879962-68879984 TTTTTAAAAAAGCAGGGGAAGGG - Intronic
1129047653 15:72750971-72750993 TCTTATCCAAAGCAGGGAAAGGG + Intergenic
1129292034 15:74575771-74575793 CATTACCAACAGAAGGGAAACGG + Intronic
1130646870 15:85736296-85736318 TAGGACCAAAGACAGGGGAAAGG - Intronic
1131433863 15:92407637-92407659 AGTTATAAAAAGCAGGGGAATGG + Intronic
1132643834 16:989839-989861 TATTCCCAAGAGCTGGGGGAAGG + Intergenic
1133630821 16:7619347-7619369 TTTTAGCCATAGCAGGGGAAGGG + Intronic
1134768236 16:16781271-16781293 TAATAACAAAAGAAGGGGGAAGG - Intergenic
1135908806 16:26540657-26540679 TATTCCCAGAGTCAGGGGAAAGG + Intergenic
1137488383 16:48910315-48910337 CATTACCAGAGGCAGGAGAATGG + Intergenic
1137946352 16:52736441-52736463 TCTTACCAAAAGAAGAGGGAAGG + Intergenic
1138020502 16:53475503-53475525 TACTACAAAAAGCAGGGCACAGG - Intronic
1140714615 16:77711189-77711211 TAATAGCAAGAGTAGGGGAATGG + Intergenic
1203144054 16_KI270728v1_random:1787993-1788015 GATTACCAGAAGCTGGGGAAGGG + Intergenic
1143301290 17:5912414-5912436 TATTTGCAAAAGCAGGGGACAGG + Intronic
1144352191 17:14407913-14407935 TTTTAATAAAAGCAGGGGGATGG - Intergenic
1144427392 17:15156709-15156731 AACTGCCATAAGCAGGGGAAGGG + Intergenic
1147417524 17:40304103-40304125 TATTTCCAAAACCAGGGGAAAGG - Exonic
1149363042 17:55913957-55913979 CATGAGCACAAGCAGGGGAAGGG + Intergenic
1153068475 18:1076947-1076969 TCTTACCAAAAGTGGGGGAGGGG - Intergenic
1153095295 18:1394550-1394572 TATAGCCAAAAGCAGGGCAGGGG + Intergenic
1153353979 18:4115240-4115262 TAGTACCCAAAAGAGGGGAAAGG - Intronic
1153753464 18:8257226-8257248 TAGACCCAAAAGCAGGAGAATGG + Intronic
1154039189 18:10836956-10836978 TATGATCAAAGGAAGGGGAAGGG + Intronic
1156092753 18:33491269-33491291 TATTATCACAACCAGGAGAATGG - Intergenic
1156403466 18:36761076-36761098 TATTTCTAAAAGCAGGGGGAAGG - Intronic
1156492580 18:37505115-37505137 TATTAGGAGAAGCAGGGGCAGGG + Intronic
1156710322 18:39936398-39936420 TAGTACAAAAAGTTGGGGAAAGG + Intergenic
1156718801 18:40044953-40044975 CATTAACAAAAGCAGGCGATGGG + Intergenic
1156811142 18:41253551-41253573 TATTACCAAAAGAAGTGCCATGG - Intergenic
1157688866 18:49664669-49664691 TATTGCCAGAAGAAAGGGAAAGG - Intergenic
1158252111 18:55500324-55500346 AATTAGGAATAGCAGGGGAAAGG + Intronic
1158443367 18:57497293-57497315 TATTCCCTAAAGCAGGCTAAAGG + Intergenic
1158699008 18:59729849-59729871 TATTAGGCAAAGCATGGGAATGG + Intergenic
1160303248 18:77705530-77705552 TAGAACAAAAAGCAGAGGAAGGG + Intergenic
1163379454 19:16955456-16955478 TGTTACCAAAGGCTGGGGGAAGG + Intronic
1163411843 19:17159766-17159788 TATTAGCAAAACCAGGTGGAGGG - Intronic
1165587400 19:36930976-36930998 TATTCACAAAAGCAGCAGAAAGG - Intronic
1165966712 19:39587414-39587436 AATGACCAAGTGCAGGGGAAAGG - Intergenic
1168143820 19:54407941-54407963 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
1168380326 19:55915023-55915045 GATTACTAGAAGCTGGGGAATGG + Intronic
925504561 2:4546902-4546924 TATGAACAAATGTAGGGGAAAGG + Intergenic
925894523 2:8461090-8461112 TGTTACCAGAAGCAGGGGAAGGG + Intergenic
927160569 2:20254894-20254916 TGTTTCCGAAATCAGGGGAAAGG - Exonic
928551838 2:32380359-32380381 CATTTCCAAAAGGAGAGGAAAGG - Intronic
930392683 2:50782170-50782192 TATTTCCAAAATTAGGAGAAGGG + Intronic
931111877 2:59119757-59119779 TAATACAAATAGCAGAGGAAAGG + Intergenic
931402133 2:61941014-61941036 TATTAACAAAAAAAAGGGAAAGG - Intronic
935376834 2:102408714-102408736 GGTTACCGACAGCAGGGGAAAGG + Intergenic
935643800 2:105315922-105315944 TATTACCCAAAAAAAGGGAACGG + Intronic
937764227 2:125640949-125640971 TAACACCAAAACAAGGGGAAAGG - Intergenic
938606647 2:132900384-132900406 TATTATCAAAACTAGGTGAAGGG - Intronic
939501889 2:142997020-142997042 TATTACAGAAAGGAGTGGAAAGG - Intronic
939511947 2:143117880-143117902 TGTTACCAAAGGCTGGGGAGTGG + Intronic
939721028 2:145651558-145651580 TATGTCCAACAACAGGGGAATGG - Intergenic
939774246 2:146364635-146364657 TATTACCAAAATTTGGGGACAGG - Intergenic
940279735 2:151976849-151976871 TTTTACTAAAAGCTGGGGACTGG - Intronic
941707301 2:168673403-168673425 TATTACCAAAAAAAAGGAAAAGG + Intronic
942075671 2:172355133-172355155 CATGTCCAAAAGTAGGGGAATGG + Intergenic
942649547 2:178152176-178152198 TATTTACAAAAGCAGGCGACAGG - Intergenic
943228818 2:185217122-185217144 TATTTCTAAAAGCAAGTGAAAGG + Intergenic
943287391 2:186020033-186020055 GATTACACAAAGCAGGGGCATGG - Intergenic
943593491 2:189827825-189827847 TGTTACCAGAAGCTGGGGAGGGG + Intronic
943778021 2:191788636-191788658 TATGACACAAAGCACGGGAAAGG + Intergenic
944136448 2:196405124-196405146 TATTACCAACAGGAGGGGCCGGG - Intronic
944360106 2:198844209-198844231 TGTCACCTAAAGCAAGGGAAGGG - Intergenic
945707984 2:213259642-213259664 GATTACCAGAAGCAGGGGAATGG - Intergenic
946173380 2:217908538-217908560 CATGTCCAAAGGCAGGGGAATGG + Intronic
946266196 2:218543995-218544017 TATTAGCAGAAGCTGGGTAAGGG + Intronic
946844135 2:223844362-223844384 AATTACAGGAAGCAGGGGAATGG - Intergenic
1168738384 20:165039-165061 TATTTCCAAAAGCAGGCTATGGG - Intergenic
1169644205 20:7790955-7790977 AATTATCAAAAGCTGGGAAATGG - Intergenic
1172550052 20:35792000-35792022 TTTTCCCAGAAGCAGTGGAAAGG - Intronic
1173647836 20:44644583-44644605 CATCACCAAAAGCAGGGCTAGGG - Intronic
1174581725 20:51576946-51576968 TATTTCCAGAAGAAGGGGAAGGG - Intergenic
1175007993 20:55706142-55706164 AATGGCCAAAAGCAGGTGAAGGG - Intergenic
1177368457 21:20170226-20170248 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
1178762384 21:35415633-35415655 TATTAAAATAAGCAGGGGCATGG + Intronic
1181725798 22:24810107-24810129 TTATCCCAAAAGCAAGGGAAAGG + Intronic
1184319802 22:43732229-43732251 AATTTCCATAAGCAGGGAAATGG + Intronic
949742747 3:7254886-7254908 TAGTACCAACAGCAGTTGAAAGG - Intronic
951702052 3:25506729-25506751 TATTTACAAAAGCAGATGAAGGG + Intronic
952017190 3:28971381-28971403 AAACACTAAAAGCAGGGGAAAGG - Intergenic
952948497 3:38497756-38497778 TATTTCCAAAAGCAAGATAATGG + Exonic
953004405 3:38964733-38964755 TATTGCCAAAAGGAGGAGCATGG + Intergenic
955144734 3:56305777-56305799 TATTTACAAAAGCAGGCAAAAGG - Intronic
955611404 3:60761066-60761088 TATAACCAGAAGAAGGGGGAGGG + Intronic
955794117 3:62617900-62617922 TGTGACCAAAAGCAGGGGCAAGG - Intronic
955887037 3:63611398-63611420 TATTACCAAAAGCAGGGGAAAGG + Intronic
957925035 3:86798429-86798451 TATGACTAAAAGCAGGGGAATGG - Intergenic
960364405 3:116753207-116753229 TATTACAATAAACAGGTGAATGG + Intronic
961936851 3:130593659-130593681 TATTGCCAAACTCAGAGGAAGGG + Intronic
962082938 3:132159810-132159832 CATTCCCAGAAGCAGGGGAAGGG - Intronic
962455141 3:135558201-135558223 TAGAACAAAAAGCAGAGGAAGGG - Intergenic
962456982 3:135573737-135573759 TGTTACCACAAGAAGGGGAAAGG - Intergenic
962668200 3:137678042-137678064 TATTACTAAAAATAGAGGAAGGG + Intergenic
962844482 3:139262733-139262755 TCTTTCCAAAAGAAGGGGAATGG - Intronic
963392482 3:144684032-144684054 TATAACGAAATGCAGGGGCAGGG - Intergenic
964315167 3:155435849-155435871 TCTTGCCAAAAACAAGGGAAAGG - Intronic
965755011 3:172016817-172016839 TACTCCCAGAAGCAGAGGAACGG - Intergenic
966135261 3:176690996-176691018 TCTTACCAAAAACAGAGTAAGGG + Intergenic
966158195 3:176940889-176940911 TATTACCAGAGGCTGGGGGAAGG + Intergenic
966242079 3:177765987-177766009 TAGTACCAAGGGCAGGGGAGGGG + Intergenic
966546379 3:181153916-181153938 TATTGCCAAAAGAAGGGAAGAGG - Intergenic
967431112 3:189386226-189386248 TTTTCCAAAATGCAGGGGAAAGG - Intergenic
968439545 4:615987-616009 TAATACCAGAAGCAGAAGAAAGG - Intergenic
972141913 4:35970876-35970898 TATTACCAAAAGAAGGAAAGAGG + Intronic
972143422 4:35990189-35990211 TAGCACAAAAAACAGGGGAAGGG + Intronic
972336508 4:38111672-38111694 TAGTAGGAAAAGCAGGGGGAGGG + Intronic
974516041 4:62912361-62912383 AATTTCCAGAAGCAAGGGAAAGG - Intergenic
974836974 4:67262867-67262889 TACTACCAGAAGCTGGGAAAAGG - Intergenic
975824060 4:78301260-78301282 TATTAACAAAAGCATAGGTAGGG + Intronic
978624690 4:110671601-110671623 TATTAGGAGAAGCAAGGGAATGG + Intergenic
979380540 4:120000994-120001016 GGTTTCCAAAAACAGGGGAATGG - Intergenic
979719138 4:123878758-123878780 TATTATCAAAAGCAAGGACATGG + Intergenic
981153169 4:141402429-141402451 TATTCCAAAAAGCAGGGGAGAGG - Intergenic
981445118 4:144827519-144827541 TAAAAACAAAAGCAGAGGAATGG + Intergenic
981684769 4:147441184-147441206 TAATGCCAAATGTAGGGGAATGG + Intergenic
981694124 4:147542234-147542256 TATTACCAAGTGCAAGAGAAAGG - Intronic
983418633 4:167489731-167489753 TAGTACCATAAGCATGGGCAAGG + Intergenic
984496267 4:180501400-180501422 TATTATTAAAAGCAGATGAATGG - Intergenic
984777923 4:183499899-183499921 GTTTTCTAAAAGCAGGGGAAAGG - Intergenic
985009103 4:185564154-185564176 TATTAGCAAAAGCAAAGGAAAGG - Intergenic
986589324 5:9352764-9352786 TATTAACAAAAACAGGTGATGGG - Intronic
986856428 5:11873952-11873974 TATTACTACCTGCAGGGGAATGG + Intronic
987589145 5:19900220-19900242 GATTACCAGAAGAAGGGGAGGGG + Intronic
987694161 5:21307152-21307174 TATTATCAAAAGTACAGGAATGG + Intergenic
988260875 5:28884516-28884538 AATTACAAAATGCAGTGGAAAGG + Intergenic
988782658 5:34537496-34537518 GGTTACCAAGAGCTGGGGAAAGG + Intergenic
990053373 5:51537618-51537640 GATTTCCAAAATCTGGGGAAAGG - Intergenic
990352875 5:54936477-54936499 TGTTAGACAAAGCAGGGGAATGG + Intergenic
990701344 5:58478244-58478266 AATTACAAAAAGCAGGAAAAGGG + Intergenic
991149525 5:63350403-63350425 TATTAGCAAAATCAGGATAAAGG - Intergenic
991746084 5:69742310-69742332 TATTATCAAAAGTACAGGAATGG - Intergenic
991751621 5:69812931-69812953 TATTATCAAAAGTACAGGAATGG + Intergenic
991797686 5:70322268-70322290 TATTATCAAAAGTACAGGAATGG - Intergenic
991825462 5:70617624-70617646 TATTATCAAAAGTACAGGAATGG - Intergenic
991830908 5:70687824-70687846 TATTATCAAAAGTACAGGAATGG + Intergenic
991890029 5:71321589-71321611 TATTATCAAAAGTACAGGAATGG - Intergenic
991906552 5:71519149-71519171 TAAGACAAAAAGCAGGGGGAGGG - Intronic
992385370 5:76279513-76279535 TTTTACAAAAAACAGTGGAATGG + Intronic
992681494 5:79157849-79157871 TATTAACAAAAGCAGGACATGGG - Intronic
994045190 5:95300912-95300934 GATTACCAGAAACTGGGGAAGGG - Intergenic
994243169 5:97447922-97447944 TATTACCAAAAGCAAAAGCAGGG + Intergenic
994714440 5:103304912-103304934 TATTATCAAAAGAAGGGGAATGG + Intergenic
997516636 5:134494611-134494633 TATTACCAGAAGAGGGGGAGTGG - Intergenic
997742802 5:136272280-136272302 TCTTCCCAAAAGGAGGGCAATGG - Intronic
999154327 5:149447455-149447477 TGTTACCAAAAGGAGGTGAAAGG + Intergenic
999983456 5:156979918-156979940 AAAGACCAAAAGCAGTGGAAAGG - Intergenic
1001235407 5:170025267-170025289 TATTTACAAAAGCAGGTGGAAGG - Intronic
1001525598 5:172426533-172426555 TGTTACCAAAAGGAGGGGAGGGG - Intronic
1001726946 5:173911601-173911623 TTTTCCCAAAATCAGAGGAAAGG - Intronic
1002429847 5:179196902-179196924 TATTTACAAAAACAGGTGAAGGG + Intronic
1003727498 6:8781829-8781851 TATTACCAGAGGCTGGGGAGGGG - Intergenic
1004125364 6:12867812-12867834 GATTACCAGAAGCAAGGGGAAGG + Intronic
1004542868 6:16568568-16568590 TAGTACCATGAGCAGGGGACAGG + Intronic
1005144755 6:22675771-22675793 TGTTACTAGAAGCTGGGGAAAGG + Intergenic
1005556746 6:26992782-26992804 TATTATCAAAAGTACAGGAATGG - Intergenic
1005695847 6:28352100-28352122 TTTTACCAAAAGGAGTGGGAGGG - Intronic
1007949220 6:45855519-45855541 TATTATAAAAAGCATGGGACAGG - Intergenic
1007972786 6:46069275-46069297 CATAACTAAAATCAGGGGAATGG + Intronic
1008962623 6:57281222-57281244 TATTCACAATAGCCGGGGAATGG - Intergenic
1009887033 6:69635763-69635785 TACTACCAAAAGAAAAGGAAAGG - Intergenic
1010710365 6:79167398-79167420 CATTGCCAGAAGCAGAGGAATGG + Intergenic
1010776762 6:79895670-79895692 TATTACCAAAAACAGGAGGGTGG + Intergenic
1012080696 6:94755068-94755090 TATTAAGAAAAGCATGGAAATGG + Intergenic
1012877389 6:104744025-104744047 TAATACCTAAAACAGTGGAAAGG + Intronic
1012938029 6:105388456-105388478 TATTACAGAAAGCAAGAGAAAGG + Intronic
1014787966 6:125639567-125639589 TAATCCCAAAAGCAGGGCATTGG + Intergenic
1014815089 6:125926526-125926548 GATTACCAGAAGAAGGGCAAAGG + Intronic
1015141705 6:129941605-129941627 TTTTCTCAAAAGCAGGGCAAAGG + Intergenic
1016015186 6:139176804-139176826 TACTACCAAAAACATGGAAACGG - Intronic
1016308484 6:142708724-142708746 GATTACCAGAAGCTGGGGAAAGG + Intergenic
1017478375 6:154823556-154823578 TATGAGCAAAAGCAGAGGCAAGG + Intronic
1017897702 6:158695063-158695085 TATTTACAAAAGCAGGGTGATGG - Intronic
1021045740 7:15921123-15921145 GATTGCCAAAAGTGGGGGAAGGG - Intergenic
1021754459 7:23837860-23837882 TGTCACCAAAAGAAGAGGAAGGG + Intergenic
1023130273 7:36996140-36996162 TATTTCCAAAAGAAAAGGAAAGG - Intronic
1023305981 7:38827401-38827423 TATTGCCAAAAGGAGGAGAAGGG + Intronic
1023558052 7:41443695-41443717 TGTCACCAAAAGGAGGGTAATGG + Intergenic
1024678041 7:51655556-51655578 TTTTACCAAATGCAGGAGACTGG + Intergenic
1026077790 7:67188671-67188693 TTTTACCAAACGCACGGGTAGGG - Intronic
1026342606 7:69447343-69447365 TGTTACCAAAGCCAGGGCAACGG - Intergenic
1026932245 7:74229852-74229874 TTTTACCTGAAGCAGGAGAAAGG - Intergenic
1027641335 7:80736982-80737004 TATTTCCAAAATCAGAGGCATGG + Intergenic
1028268850 7:88761676-88761698 CATAACCAAAAGGAGGGCAAGGG - Intronic
1028426469 7:90695605-90695627 TATAAACAAAAGCAAGGAAAGGG + Intronic
1028552742 7:92088848-92088870 TATTATCAAAACCAGGAAAATGG - Intronic
1029139249 7:98398671-98398693 TATTACCCAAAGAACGGAAACGG - Intronic
1029840719 7:103360290-103360312 TAATACCAAACCCTGGGGAAAGG - Intronic
1029994828 7:104997167-104997189 TGTTACCAAAAAAATGGGAATGG - Intergenic
1030013825 7:105198415-105198437 GATTACCAAGATCAGGGGCAGGG - Intronic
1030346185 7:108435446-108435468 TAGTTCCAAAAGCAGAGGAGAGG + Intronic
1031496900 7:122460928-122460950 TATTGACAAAAGCAGATGAAAGG - Intronic
1031684763 7:124719761-124719783 TATTTCCAAATGCAGGGAAATGG - Intergenic
1032901263 7:136311294-136311316 GATTCCAACAAGCAGGGGAAAGG - Intergenic
1035420010 7:158719712-158719734 AATGACCAACAGGAGGGGAAAGG + Intergenic
1036670406 8:10781273-10781295 TATTGCCAAAAGCAGTGTCAAGG - Intronic
1039947791 8:42144833-42144855 GGATCCCAAAAGCAGGGGAAAGG - Intergenic
1041522687 8:58772698-58772720 CATAAACAAAAGCATGGGAAGGG - Intergenic
1041799547 8:61784326-61784348 TCTGACCCAATGCAGGGGAAGGG + Intergenic
1042104345 8:65308798-65308820 TTTTTCCAAAATCAAGGGAAAGG + Intergenic
1042497912 8:69476267-69476289 TAGAAAGAAAAGCAGGGGAATGG - Intronic
1042653615 8:71070280-71070302 TATTTCAAAATGCAGAGGAAAGG - Intergenic
1042797266 8:72678107-72678129 TATTACAAAAAGGAGGGCTAAGG - Intronic
1043256104 8:78138616-78138638 TCTTGCCAAAAGTATGGGAATGG - Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045788188 8:105949664-105949686 TATTACTAACAACATGGGAATGG + Intergenic
1046069893 8:109237843-109237865 TACTTCCAAAATAAGGGGAATGG + Intergenic
1046331395 8:112719996-112720018 CATGACCAAAAGCACAGGAAAGG - Intronic
1046370948 8:113305437-113305459 TTTTACCGAAAGCAGGCTAATGG + Intronic
1046704179 8:117432596-117432618 TATTACTAAAAGAGGGAGAATGG - Intergenic
1047289616 8:123518073-123518095 TATTTACAAAAGCAGGTGGAGGG + Intronic
1047417509 8:124677225-124677247 TTTTACCAAAGGCAAGGAAAAGG + Intronic
1048055877 8:130864448-130864470 GATTACCAAAAGGAGAAGAAAGG - Intronic
1048096064 8:131295976-131295998 GATTACCAAGAGCTGGGGATGGG - Intergenic
1050037749 9:1455077-1455099 GATTTCCAAAAGAAGGGGACTGG - Intergenic
1050136450 9:2470522-2470544 TTTTAAAAAAAGCAGGGGCAGGG + Intergenic
1055205048 9:73719092-73719114 TATTTTCAAAAGCAGCTGAAAGG + Intergenic
1055289785 9:74770688-74770710 TTTTGCCCGAAGCAGGGGAACGG - Intronic
1056092860 9:83221260-83221282 TATTGCTAAAAGGAGGTGAAAGG + Intergenic
1056159895 9:83878728-83878750 GATTACCAAGAGCTGGGGGAAGG + Intronic
1056360331 9:85851089-85851111 GATTACCAAGAGCTGGGGGAAGG - Intergenic
1058985521 9:110206216-110206238 AGTTACCAAGAGCAGGAGAAAGG + Intronic
1059473661 9:114526504-114526526 TATTCCCAGAAGAGGGGGAAAGG - Intergenic
1059779487 9:117511235-117511257 TAGTGGCAAAAGCAGGTGAATGG - Intergenic
1060365730 9:123011385-123011407 CATTAACAAAAGCATGGGGATGG + Intronic
1185534844 X:852883-852905 GATTACCATAAGCTGGGGAAGGG - Intergenic
1186196735 X:7116597-7116619 CATTACCAAAGGCTGGGCAAGGG - Intronic
1186900974 X:14055665-14055687 GGTTACCAGAAGCTGGGGAAGGG - Intergenic
1187841237 X:23490847-23490869 AATTAGCAAATGAAGGGGAAAGG + Intergenic
1188032097 X:25275568-25275590 TATTACCTCAATCAGAGGAATGG - Intergenic
1190123978 X:47687075-47687097 CATCACCAAAAGAAGGGGATGGG + Intergenic
1192457204 X:71286713-71286735 AATTTCCAAAATTAGGGGAATGG - Intronic
1193278205 X:79616249-79616271 TAGTACCAAGAGCTGGTGAAAGG - Intergenic
1195327785 X:103772062-103772084 TATTTCAAAGAGCAGAGGAATGG + Intergenic
1195749986 X:108154550-108154572 TATTTACAAAAGCAGGTGGAGGG + Exonic
1198653387 X:138888214-138888236 TATTCCCAAGAGCATTGGAATGG - Intronic
1198839549 X:140841712-140841734 TATTCCCAGAAGCAGGAGAGGGG - Intergenic
1201199125 Y:11523261-11523283 TGTTACCAAATGGAAGGGAATGG + Intergenic
1201569393 Y:15398120-15398142 TATTACCAAAGGCTAGGCAAGGG - Intergenic