ID: 955887218

View in Genome Browser
Species Human (GRCh38)
Location 3:63613290-63613312
Sequence GGACCATTTTACCATGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955887218 Original CRISPR GGACCATTTTACCATGTGCA TGG (reversed) Intronic
906086903 1:43143957-43143979 CGTCCATTTTACCATGAGGACGG - Intergenic
908328617 1:63048525-63048547 AGACAATTTTTCCATGGGCAGGG + Intergenic
912714252 1:111971132-111971154 GGACCATTTCTCCTTGTCCAAGG - Intronic
916204708 1:162304839-162304861 GGTCCATTTTATCATGAACAAGG + Intronic
917154924 1:171986158-171986180 GGAGGATTTTTACATGTGCAGGG - Intronic
921717709 1:218435237-218435259 GGAGTATTTTTCCATGAGCAAGG - Intronic
922853013 1:228750161-228750183 GGGCCAATTTACCATGTGGCTGG - Intergenic
923359479 1:233195794-233195816 GGAACAATATACCATGTTCATGG + Intronic
1064072774 10:12245057-12245079 GGATTTTTTTACCATATGCAAGG - Intronic
1069294518 10:66827476-66827498 GGACAATATTACTATGTGCTGGG - Intronic
1073020116 10:100436313-100436335 GGACCATTTCAGCATCTGCATGG + Intergenic
1073020534 10:100439960-100439982 GTACCATTTCAGCATCTGCATGG + Intergenic
1073487761 10:103831381-103831403 GCACAATTCTACCATGTGCCTGG - Intronic
1074784705 10:116828676-116828698 GGAGCATTAAACCACGTGCAGGG + Intergenic
1075248046 10:120841580-120841602 TGAGCATTTAACCATGTGCTAGG - Intergenic
1076277667 10:129217983-129218005 GGACTATTTAACCATGTAAATGG - Intergenic
1084698203 11:70768850-70768872 GGCCCCTCTTCCCATGTGCAGGG - Intronic
1087924146 11:103900079-103900101 TGCCCATTTTACAATGTGCCAGG - Intergenic
1088718079 11:112566357-112566379 GCACTATATAACCATGTGCAGGG - Intergenic
1091070765 11:132560688-132560710 GGAGCATTTTTCCATATGCTTGG + Intronic
1091801459 12:3327193-3327215 GGACAGTTTAACCATGTGGAAGG - Intergenic
1100899634 12:99223278-99223300 AGACAATTTTTCCATGGGCAGGG + Intronic
1104095457 12:125553146-125553168 GGACCATTTTATAATTTGCACGG + Intronic
1106751582 13:32775672-32775694 GGACTATTTCACAATTTGCATGG - Exonic
1107410907 13:40158149-40158171 CAACCATTTTACCATGCCCATGG + Intergenic
1112981829 13:105394227-105394249 TGTCCATTTTACCATGTCCTAGG - Intergenic
1113951387 13:114073309-114073331 GTCCCATTTTCCCATGTGTAGGG - Intronic
1113951405 13:114073441-114073463 GTCCCATTTTCCCATGTGTAGGG - Intronic
1119630702 14:76229531-76229553 GGCCCATATTAACATGTGGAGGG - Intronic
1120397982 14:83992599-83992621 GGGCAATTTTACCATGTGCGTGG + Intergenic
1124214280 15:27793727-27793749 GGACCATTCTGCGGTGTGCAAGG + Intronic
1128401852 15:67291307-67291329 TGAGCACTTTACCATGTGCCAGG - Intronic
1129915728 15:79268819-79268841 GGAACAGACTACCATGTGCAGGG - Intergenic
1135163557 16:20118415-20118437 GGTCCATTATCCAATGTGCATGG - Intergenic
1137052122 16:35723319-35723341 TCACCATTTTTCCATCTGCAAGG + Intergenic
1140911078 16:79453433-79453455 GGACCATTCTGCCATCAGCAAGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144513182 17:15895128-15895150 GGACCATCTAATCATGTGGATGG - Intergenic
1145760670 17:27424008-27424030 TGACCATATTCCCATGTTCACGG + Intergenic
1147195686 17:38765152-38765174 TGTCCATTCTTCCATGTGCATGG + Intergenic
1147336588 17:39730068-39730090 CGGACATTTTACCATGTGCCAGG + Intronic
1151955645 17:77378874-77378896 GGACCATATGCCCATCTGCAGGG + Intronic
1152153267 17:78616186-78616208 GGATGATTTTGCCATGTCCAGGG + Intergenic
1152720551 17:81921745-81921767 AGACCATTTGACCATATGAATGG - Exonic
1159792559 18:72800654-72800676 AGACAATTTTTCCATGTGCTGGG - Intronic
1163219494 19:15905060-15905082 GGAACATCTTCCCATGTTCATGG - Intergenic
1165348365 19:35262920-35262942 GGACATTTTTACCATGTGTATGG - Intronic
1167360022 19:49025027-49025049 GGCACATTTCACGATGTGCATGG - Intronic
1167361061 19:49030744-49030766 GGCACATTTCACGATGTGCATGG + Intronic
1167362588 19:49038053-49038075 GGCACATTTCACGATGTGCATGG - Intergenic
1167363543 19:49043131-49043153 GGCACATTTCACGATGTGCATGG + Intergenic
925462396 2:4074714-4074736 AGACGATTTTTCCATGGGCAGGG - Intergenic
926365407 2:12128738-12128760 GAACCATGGCACCATGTGCATGG - Intergenic
928113703 2:28529861-28529883 GTACCATTTTACCATGAACTCGG + Intronic
929633161 2:43487426-43487448 GGACTATTTTACAAAGTGAATGG + Intronic
930432346 2:51295024-51295046 GGAACATACTACCATGTACATGG + Intergenic
930591191 2:53328423-53328445 GGACAATTTTTCCATGTACCAGG + Intergenic
930766388 2:55089834-55089856 GGACCTTTTTACCACATGCCTGG - Intronic
931174704 2:59842041-59842063 AGACCATTTTACTTTGTGCTTGG + Intergenic
932339441 2:70952066-70952088 TTAGCATTTTACCATGTACAAGG + Intronic
936263184 2:110979654-110979676 GGCTCTTTATACCATGTGCATGG + Intronic
936638064 2:114281902-114281924 TGACCATTTCACCAAGTGCAAGG - Intergenic
937694997 2:124799116-124799138 GGATCATTTTTCAATTTGCATGG + Intronic
941191339 2:162386787-162386809 AGAACATTCTACCATGTGTAAGG - Intronic
942808871 2:179972310-179972332 GGACAATTTTAGCATTTTCATGG + Intronic
944515846 2:200510740-200510762 GCACCATCTTACCTTGTGCAAGG + Intronic
946961004 2:224985872-224985894 AGACCTTTTTACAATGGGCAAGG + Intronic
947650932 2:231786058-231786080 TGAGCGTTTTACCATGTGCCAGG - Intronic
948639178 2:239363167-239363189 GGAGGAATATACCATGTGCATGG + Intronic
1170876533 20:20254886-20254908 GTAGTATTTTACCTTGTGCATGG - Intronic
1183096747 22:35556682-35556704 GGACCTTGTCACCATCTGCACGG + Intergenic
949630802 3:5924120-5924142 TCCCCATTTTTCCATGTGCATGG + Intergenic
951267832 3:20590151-20590173 TGAGCATTTTCTCATGTGCATGG + Intergenic
953725730 3:45396656-45396678 TGAGCATTTAACCATGTGCCAGG + Intronic
955887218 3:63613290-63613312 GGACCATTTTACCATGTGCATGG - Intronic
956304489 3:67809015-67809037 TCACCATTCTACCATGTACAAGG + Intergenic
957334857 3:78814863-78814885 GGGCCATTTTCCCAAGAGCATGG + Intronic
961398515 3:126616212-126616234 GAACCATGAAACCATGTGCATGG + Intronic
962887697 3:139642690-139642712 AGACCATTCTACCAGATGCAGGG - Intronic
968461094 4:725445-725467 GGACCATCTGACCCAGTGCATGG + Intronic
970655954 4:18230105-18230127 TGTCCATTGTACCATGTGCCTGG + Intergenic
972483145 4:39517106-39517128 GGATAATTTTACCCTGTGAAAGG - Intronic
972678039 4:41278895-41278917 TGAACATTTTTCCATGTTCATGG - Intergenic
981609450 4:146577825-146577847 AGACAATTTTTCCATGGGCAGGG + Intergenic
984064169 4:175027619-175027641 TCATCATTTAACCATGTGCATGG - Intergenic
984578475 4:181479531-181479553 GGACCATTTTTCCAAGAGAAAGG - Intergenic
984760482 4:183358742-183358764 GGACCAGTGGACCATCTGCAAGG + Intergenic
986715737 5:10522307-10522329 GAACCATTTTCCCATGCCCAGGG - Intergenic
987703029 5:21426402-21426424 TGACCTTTTTTCCATGTGCATGG + Intergenic
989117043 5:37965165-37965187 GGAACATTTTACTATGTGGTTGG + Intergenic
989592256 5:43122092-43122114 GGATCATTTTATGATGTTCAGGG - Exonic
993712907 5:91245593-91245615 GAATAATTTCACCATGTGCATGG + Intergenic
995695518 5:114874743-114874765 GAACCATTTTAACTTCTGCAGGG - Intergenic
998635323 5:143948478-143948500 GGACCATTTTACTGTGTTCTTGG + Intergenic
1001600590 5:172925790-172925812 GGAGCATGCTACCATGGGCATGG - Intronic
1005645638 6:27835213-27835235 AGACAAATTTACAATGTGCATGG - Intergenic
1009470191 6:64023443-64023465 GTACCATTTTACGCTGTACATGG + Intronic
1009558424 6:65205619-65205641 GGAACATTTGACCATATGCTTGG + Intronic
1012873053 6:104694802-104694824 AGAGCATTATACCAAGTGCAGGG - Intergenic
1013401690 6:109803012-109803034 GGACCATCTCCCCATGTGAAGGG - Intronic
1013725370 6:113089011-113089033 GGACAATTTTTCCATGGGCCAGG + Intergenic
1017781567 6:157719333-157719355 AGACCATTTTACCCTGAGCTTGG - Intronic
1024256601 7:47544327-47544349 GGTCCGTTTTACCATGAGAAAGG - Intronic
1026614044 7:71886001-71886023 CCACCATTTTAACATGTGAATGG + Intronic
1027952471 7:84835209-84835231 GGTCCATTTTTCCAGGTGCTTGG + Intergenic
1030286165 7:107829143-107829165 AGACAATTTTACAATGTACAGGG + Intergenic
1033777178 7:144625385-144625407 GAACCATTTCACCTTGTGAATGG - Intronic
1034195200 7:149240808-149240830 GGAAAATTTGACCATGAGCAGGG + Intronic
1034545117 7:151784435-151784457 GGGCCATTTATCCATCTGCATGG - Intronic
1035531294 8:353432-353454 GGGTCATTTTATCATCTGCATGG - Intergenic
1038098556 8:24344244-24344266 GGAACATTTTACCCTGAGGAGGG + Intronic
1044296531 8:90534445-90534467 TGACCATTTTACCATGGGTGAGG + Intergenic
1044337603 8:91005810-91005832 GGTCCATTATAACATTTGCATGG + Intronic
1045095842 8:98797374-98797396 GGACAAGTATATCATGTGCAAGG + Intronic
1047186826 8:122640824-122640846 GGACCATTTCCCGATGTGCCTGG - Intergenic
1051190785 9:14509771-14509793 GGGCCATTTCACCATGGGCTGGG - Intergenic
1051782270 9:20702658-20702680 TGAGAATTTTACCATGTGCCAGG - Intronic
1056119716 9:83475695-83475717 AGATCACTTTACCATGTACAAGG + Intronic
1056534603 9:87516764-87516786 GGGGCATTTTCCCATGTGCTAGG + Intronic
1056769515 9:89466700-89466722 AGACCATGTTTCCATGTGCTGGG - Intronic
1056993917 9:91436919-91436941 AGACAATTTTTCCACGTGCAAGG + Intergenic
1192606552 X:72524952-72524974 AGACAATTTTTCCATGGGCATGG + Intronic
1193683356 X:84548928-84548950 GGAACACTTTTCCATGTTCATGG - Intergenic
1196117246 X:112011117-112011139 GAACCAGTCTACCATGTACATGG - Intronic
1196786928 X:119428945-119428967 GGACCATTTTTCCACGGACAAGG - Intronic
1199605846 X:149579170-149579192 AGACAATTTTTCCATGAGCACGG - Intergenic
1199633275 X:149790198-149790220 AGACAATTTTTCCATGAGCACGG + Intergenic