ID: 955887285

View in Genome Browser
Species Human (GRCh38)
Location 3:63614043-63614065
Sequence GATGATCCACAGTGGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955887285_955887288 -3 Left 955887285 3:63614043-63614065 CCCACAGGCCACTGTGGATCATC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 955887288 3:63614063-63614085 ATCTCACTGTCCAGAAACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 153
955887285_955887291 20 Left 955887285 3:63614043-63614065 CCCACAGGCCACTGTGGATCATC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 955887291 3:63614086-63614108 GATAGATATTGACCCAGCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 100
955887285_955887289 -2 Left 955887285 3:63614043-63614065 CCCACAGGCCACTGTGGATCATC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 955887289 3:63614064-63614086 TCTCACTGTCCAGAAACTAAGGG 0: 1
1: 0
2: 1
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955887285 Original CRISPR GATGATCCACAGTGGCCTGT GGG (reversed) Intronic
900543342 1:3215276-3215298 GATGATCCACAGGTGCCACTGGG + Intronic
905311642 1:37053008-37053030 GATGATCCCCCGTGGCCAGGAGG + Intergenic
905503243 1:38455891-38455913 GATGATTCACACTGGTCTGGTGG - Intergenic
905640976 1:39589629-39589651 CATGAGCCACAGTGCCCTGCTGG + Intergenic
905805793 1:40876506-40876528 GATGGTCCAGGGTGGCCTGAAGG - Intergenic
906274537 1:44506329-44506351 GATGGTCTTCAGTGGCCAGTGGG + Intronic
906713972 1:47953215-47953237 GATGATGCACAGAGGGGTGTGGG + Intronic
908754242 1:67453488-67453510 GATGATCCATAGTAGTCTTTAGG + Intergenic
910031608 1:82732317-82732339 GATCATCCACTGTGGACTGTGGG - Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913138409 1:115915272-115915294 GAGTTTCCACAGTGGGCTGTTGG - Intergenic
916803411 1:168235437-168235459 GATGAGCCACAGTGGTGTGGTGG + Intronic
917786656 1:178466176-178466198 GATGATCCACAGAACCCTGAAGG + Intronic
921071336 1:211660697-211660719 GAAGATCCACATTGCCCTGGGGG + Intronic
1063729450 10:8678977-8678999 GTTGACCCACAGTTGCTTGTAGG + Intergenic
1063749073 10:8921854-8921876 GATGGTCTAGAGTAGCCTGTTGG + Intergenic
1064107742 10:12514445-12514467 GATGCTACACACTGCCCTGTGGG + Intronic
1064149245 10:12849183-12849205 GAAGAGCCACAGTGGCTTCTGGG + Intergenic
1064169589 10:13018473-13018495 GAAGACACACAGTGGCCTGTAGG - Intronic
1068333229 10:55600034-55600056 GATGATACATTGGGGCCTGTTGG - Exonic
1072312293 10:94168072-94168094 GAAGAGCCACAGTGTCCAGTGGG + Intronic
1072511342 10:96129425-96129447 GAGGAGCCACACTGGCCTTTGGG + Intergenic
1078506199 11:11948823-11948845 GATGACAAACAGTGGCCTGAGGG - Intronic
1080830729 11:35891088-35891110 GATGAGCCACTGTGCCCTGCTGG + Intergenic
1083381384 11:62271877-62271899 CATGATCTACAGTTGCCTATTGG - Intronic
1084680558 11:70663939-70663961 GGTGATCCCAAGAGGCCTGTAGG - Intronic
1084685804 11:70694529-70694551 AATTATCCACAGTAGGCTGTGGG - Intronic
1085047279 11:73360868-73360890 GAAGATCCACAGAGACCTCTGGG + Intronic
1085652469 11:78280794-78280816 GATGATCCGCAGAGGCTTCTTGG + Exonic
1088111715 11:106268680-106268702 TATCACACACAGTGGCCTGTTGG - Intergenic
1088867867 11:113866054-113866076 GGTGATCCACATTGGCCTCCCGG - Intronic
1089350947 11:117821440-117821462 GCAGATCCACGGTGGTCTGTTGG + Intronic
1100509921 12:95260385-95260407 GGTGAACCACAGTGCCCAGTGGG + Intronic
1101321252 12:103674980-103675002 AATCATCCACAGAGGACTGTCGG + Intronic
1101742850 12:107514406-107514428 CAGGATCCACAGTGGGCTGGAGG - Intronic
1104589766 12:130074971-130074993 GGGGCTCCACATTGGCCTGTGGG + Intergenic
1113419800 13:110162304-110162326 GATGACCCACAGTGTCCTTCTGG - Exonic
1113639964 13:111950107-111950129 ACTGATCCACAGTGGCCTCAAGG - Intergenic
1115542869 14:34439112-34439134 TATGCTCCAGAGTGCCCTGTGGG - Intronic
1116737638 14:48713371-48713393 GATGAACCACAAAGGCCTCTAGG + Intergenic
1116774362 14:49163139-49163161 GATGATCTCCAGTTGTCTGTAGG - Intergenic
1117557054 14:56896364-56896386 GATGATCTAGAATGCCCTGTTGG + Intergenic
1122718986 14:103711832-103711854 GGGGATGCAGAGTGGCCTGTTGG - Exonic
1131410028 15:92199967-92199989 CATCACACACAGTGGCCTGTTGG + Intergenic
1133429385 16:5723468-5723490 TTTAATCCACAGTTGCCTGTGGG - Intergenic
1134717507 16:16364221-16364243 CATGCTCCACTGTGGCCTCTGGG - Intergenic
1134957245 16:18387938-18387960 CATGCTCCACTGTGGCCTCTGGG + Intergenic
1136161141 16:28419569-28419591 GATGAGCCACAGTGGCATTTTGG + Intergenic
1136201824 16:28695422-28695444 GATGAGCCACAGTGGCATTTTGG - Intronic
1136218167 16:28809614-28809636 GATGAGCCACAGTGGCATTTTGG - Intergenic
1141852638 16:86657851-86657873 GATGAGCCACCTTGGCCAGTGGG + Intergenic
1144034192 17:11350598-11350620 GATGATTGACAGTGGACTGAGGG - Intronic
1144850312 17:18240873-18240895 GGTGAGCCACTGTGGGCTGTGGG + Exonic
1146729806 17:35183638-35183660 GATCATCCAGTGTGGTCTGTGGG - Intronic
1147452500 17:40514537-40514559 GATAATACAAAGTGGCATGTTGG + Intergenic
1150736866 17:67748250-67748272 CATGAGCCACTGTGCCCTGTTGG - Intergenic
1154165261 18:12009930-12009952 GATGATCCACGTCGGGCTGTGGG - Exonic
1155166590 18:23237186-23237208 GATGACCCCCAGTGGCCTTGTGG + Exonic
1155347818 18:24875995-24876017 GTTGTTCCCCAGTGGCCTGAGGG - Intergenic
1158206069 18:54994273-54994295 GATGATCCACAGAGAACTGAAGG - Intergenic
1158229485 18:55237890-55237912 GAAGAAACACAGTGGACTGTCGG + Intronic
1158507752 18:58061455-58061477 GAAGATGCACATTGGACTGTGGG + Intronic
1159351811 18:67285055-67285077 GATTTTCCTCAGTGGTCTGTTGG + Intergenic
1161407505 19:4098747-4098769 CATGGCCCTCAGTGGCCTGTTGG - Intronic
1165455757 19:35909591-35909613 GCAGATGCCCAGTGGCCTGTGGG + Intergenic
1168305248 19:55431812-55431834 GGTGATCCAGAGTGGCCTCCTGG + Exonic
929501187 2:42493189-42493211 GATGATCTACTGGGGCCTGGAGG - Exonic
931139049 2:59436868-59436890 GGTGAGACAAAGTGGCCTGTGGG + Intergenic
932434741 2:71696428-71696450 GATGAGCCACAGAGGGCTGAAGG - Intergenic
934317704 2:91940622-91940644 GGTGCTCCACGGTGGCCAGTAGG + Intergenic
935543043 2:104371961-104371983 GCTGATCAGCAGTGGGCTGTAGG - Intergenic
937102808 2:119284495-119284517 GGTGATCCACTGAGGCCTCTTGG - Intergenic
937305259 2:120867010-120867032 GAAGGTGCACAGTGGCCTGGGGG + Intronic
938722111 2:134076332-134076354 GAGGCTCCACAGGGGCCTGCAGG - Intergenic
940417558 2:153440113-153440135 CATTACCCACTGTGGCCTGTTGG - Intergenic
941415327 2:165213600-165213622 GATGATCCAAAGTGGCTGGTGGG - Intergenic
943932130 2:193868033-193868055 GTAGATCAACACTGGCCTGTAGG + Intergenic
944637110 2:201685073-201685095 GATCATCCACGGTGGGCTGGCGG - Exonic
945502904 2:210599781-210599803 AATGCTCCAGAGTGGCCAGTAGG + Intronic
947331769 2:229036306-229036328 GATGACACACAGAAGCCTGTAGG - Intronic
947770633 2:232667474-232667496 GACGAGACACAGTGGCCTGGAGG - Intronic
949017116 2:241719760-241719782 GAAGATCCACTGTGGCCTCATGG + Intronic
1168972603 20:1941193-1941215 GATGATCCCCAGTGGGCTTGTGG - Intergenic
1170061182 20:12260858-12260880 GAGGATGCACAGTGGGCTGCAGG + Intergenic
1170169706 20:13396964-13396986 TAAGAACCAAAGTGGCCTGTAGG - Intronic
1172536900 20:35680929-35680951 GATAATTCACAGTGCACTGTGGG - Intronic
1173864389 20:46305084-46305106 GATGATACACAGTGGCTGCTTGG - Intronic
1175317032 20:58055656-58055678 GGGGAGCCACACTGGCCTGTTGG - Intergenic
1176116860 20:63435907-63435929 GATGAACCACTGTGGCCAGAGGG - Intronic
1178581217 21:33839990-33840012 CATTAACCACAGTGGCCAGTGGG - Intronic
1178714574 21:34952204-34952226 CATCATCCACCGGGGCCTGTCGG + Intronic
1179990424 21:44945474-44945496 GATGAGCCACAGGGGCTTGAAGG - Intronic
1183110091 22:35642487-35642509 GCTGCTCCTCAGTGGCCTGGTGG + Intergenic
1184724051 22:46332728-46332750 GGTGATACACAGGGGCCTCTTGG + Intronic
951609332 3:24473931-24473953 CATCATACACTGTGGCCTGTTGG + Intronic
955887285 3:63614043-63614065 GATGATCCACAGTGGCCTGTGGG - Intronic
961039364 3:123666414-123666436 CATTGTCCACAGTGGTCTGTTGG + Intronic
961466537 3:127085173-127085195 GATGAGCCACAGGGGCTTGCAGG + Intergenic
961973546 3:130995924-130995946 CATGAGCCACAGTGCCCGGTTGG + Intronic
965737651 3:171838570-171838592 CAATATCCACAGTAGCCTGTGGG + Intergenic
973928150 4:55760934-55760956 CATCATACACAGGGGCCTGTCGG + Intergenic
984650086 4:182261863-182261885 CACGATCCACAGTGACCTGGAGG - Intronic
986238923 5:5939552-5939574 GATGAACAACAGTGGACAGTGGG - Intergenic
986480156 5:8178572-8178594 GATGATCCATGGTGGGCTGGAGG + Intergenic
990599701 5:57345594-57345616 CATGTTCCACAGTGGCTAGTAGG + Intergenic
991417498 5:66407418-66407440 TAGGATCTACAGTGGCATGTGGG - Intergenic
991540888 5:67726830-67726852 GATGATCCATGGTGGTGTGTGGG - Intergenic
997462088 5:134059589-134059611 GCTGATGCTCAGAGGCCTGTGGG - Intergenic
999702962 5:154244967-154244989 GCTGATCACCAGGGGCCTGTGGG + Intronic
1003305975 6:4929587-4929609 GATGAACCTGAGTGCCCTGTAGG - Intronic
1006703948 6:36001103-36001125 TATGATCCACAATGGCCAGTTGG + Intronic
1009280619 6:61746320-61746342 CATCACACACAGTGGCCTGTCGG - Intronic
1011172826 6:84525019-84525041 GATAATCCACAATTGCCCGTTGG - Intergenic
1012517137 6:100075377-100075399 AGTCATCCACAGTGGACTGTAGG - Intergenic
1016958482 6:149649335-149649357 GATGAGCCACTGTGCCCAGTCGG - Intergenic
1026839205 7:73659653-73659675 CATGAGCCACGGTGCCCTGTTGG - Intergenic
1027250820 7:76397755-76397777 GATCCTGCACAGTGGCCTGTGGG - Exonic
1027261870 7:76470599-76470621 GAAGATCCACATTGCCCTGGGGG + Intronic
1027313252 7:76968698-76968720 GAAGATCCACATTGCCCTGGGGG + Intergenic
1028601530 7:92605852-92605874 GAGTTACCACAGTGGCCTGTCGG - Exonic
1028892572 7:96004768-96004790 CAAAATCCACAGTGTCCTGTAGG + Intronic
1030897001 7:115072983-115073005 GATTGTCCACAGTGGCGTGTAGG - Intergenic
1031906402 7:127464738-127464760 TATGATTCACAGCAGCCTGTTGG - Intergenic
1033610675 7:142961089-142961111 GATGTCTCACAGGGGCCTGTGGG + Exonic
1035634494 8:1134009-1134031 CAACATCCACAGGGGCCTGTGGG - Intergenic
1037190678 8:16120526-16120548 GATACTCCACAGCGGCCAGTGGG - Exonic
1044146741 8:88725250-88725272 TATGGTCCCCAGTGGCCTGCAGG - Intergenic
1049425913 8:142537796-142537818 GAGGCTCCACAGGGGGCTGTTGG - Intronic
1049575138 8:143386383-143386405 GGTGGGCCACAGTGGCCGGTGGG + Intergenic
1052082007 9:24218011-24218033 GATAAAGTACAGTGGCCTGTTGG - Intergenic
1052928493 9:34038060-34038082 GATGATCCACCTTAGCCTCTTGG - Intronic
1056629445 9:88281177-88281199 GATGATCCACAGTTACCACTGGG - Intergenic
1056753706 9:89369208-89369230 TAGCAGCCACAGTGGCCTGTTGG - Intronic
1059618641 9:115978713-115978735 GATGATCTTCAGTGGACTTTTGG - Intergenic
1061316737 9:129801098-129801120 CAGGATGCACAGAGGCCTGTGGG - Intergenic
1061432979 9:130543053-130543075 GCTGGTCCACAGGGCCCTGTGGG + Intergenic
1062293967 9:135813880-135813902 GTGGATCCACAGCAGCCTGTGGG - Intronic
1187944363 X:24411993-24412015 CTTGAGCCAAAGTGGCCTGTTGG - Intergenic
1188884655 X:35534556-35534578 CATGAGCCACAGTGCCCAGTTGG - Intergenic
1190619954 X:52277095-52277117 CATGGGCCACAGTGTCCTGTTGG + Intergenic
1198154882 X:133949318-133949340 CAGGAGCCACTGTGGCCTGTAGG + Intronic
1199747676 X:150784215-150784237 GATCACCCTCACTGGCCTGTTGG - Intronic
1201075801 Y:10187520-10187542 GTGGTTCCACAGTGGGCTGTGGG - Intergenic