ID: 955887625

View in Genome Browser
Species Human (GRCh38)
Location 3:63617806-63617828
Sequence CATGACAGCTTATAAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955887625_955887626 -8 Left 955887625 3:63617806-63617828 CCTCTGCTTTATAAGCTGTCATG 0: 1
1: 0
2: 5
3: 13
4: 167
Right 955887626 3:63617821-63617843 CTGTCATGAACTCAGCAAAGTGG 0: 1
1: 0
2: 2
3: 24
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955887625 Original CRISPR CATGACAGCTTATAAAGCAG AGG (reversed) Intergenic
900781736 1:4623090-4623112 CATGACAGATTCTAACTCAGTGG - Intergenic
901741057 1:11342253-11342275 CAAAGCTGCTTATAAAGCAGTGG - Intergenic
906542881 1:46601719-46601741 CCTGACAGCTCATAAAACAAGGG + Intronic
906646029 1:47475740-47475762 CATGACAGCTTGACAGGCAGTGG + Intergenic
910243966 1:85119448-85119470 CACCAAAGTTTATAAAGCAGGGG + Intronic
910451320 1:87348890-87348912 AATCACAACTAATAAAGCAGAGG + Exonic
910759752 1:90722767-90722789 CATGACTGCATCTCAAGCAGTGG + Intergenic
913050414 1:115112686-115112708 CATGACAGACTAGAAACCAGAGG + Intergenic
914461332 1:147888545-147888567 CATCACTGCCTATAAAGCTGTGG - Intergenic
915414947 1:155734492-155734514 CATGACAGAAAATAAAGAAGTGG - Intronic
917230657 1:172833961-172833983 CTTCACAGTTTATAAAGCACCGG - Intergenic
919141495 1:193578098-193578120 CATGACAGCATAAAATGCAAAGG - Intergenic
921382169 1:214535002-214535024 CATGACAAGTTATATAGTAGCGG + Intronic
1063007534 10:1987779-1987801 CATGACAGCATAGACAGAAGAGG - Intergenic
1063236601 10:4123445-4123467 CAACACAGTTGATAAAGCAGTGG + Intergenic
1063263390 10:4416553-4416575 CACAACAGCTTACAAAGCACTGG - Intergenic
1066703510 10:38154363-38154385 CCAGACAGCTTACAAAGCAGGGG + Intergenic
1066987264 10:42478909-42478931 CCAGACAGCTTACAAAGCAGGGG - Intergenic
1069412148 10:68164667-68164689 CTTGACAGCTAATAAAGAGGAGG - Intronic
1069512703 10:69054023-69054045 CGGGACAGCTTCTAGAGCAGGGG - Intergenic
1074164423 10:110862418-110862440 GAAGACATCTTAAAAAGCAGAGG - Intergenic
1074205511 10:111279635-111279657 CATGACAGGCTAGTAAGCAGTGG + Intergenic
1075288914 10:121211488-121211510 ACTGGCAGCTTATAAAGGAGGGG - Intergenic
1077034245 11:487244-487266 CACGACAGCCTAGAGAGCAGGGG - Intronic
1078539908 11:12204986-12205008 CATGGCAGGTTTTAGAGCAGAGG + Intronic
1079198279 11:18350985-18351007 CATGACATTTTAAAAATCAGTGG + Intronic
1079886130 11:25991604-25991626 CAAGAAAGCTTTTAAAGCAACGG - Intergenic
1081232094 11:40598238-40598260 GAAGAAAGCTTAAAAAGCAGAGG - Intronic
1082863840 11:57880324-57880346 CATGTCAGTTTGTAAAGCATGGG + Intergenic
1085650290 11:78261746-78261768 CATGTAAGCTCATAAAGCATAGG - Intronic
1089309714 11:117549814-117549836 CCTGTAAGCTTAAAAAGCAGAGG - Intronic
1099334163 12:81332272-81332294 GATGCCAGCTTATGAAGCAAAGG - Intronic
1100397136 12:94195149-94195171 CATGACAGGGTTTTAAGCAGAGG + Intronic
1103647271 12:122404235-122404257 CTGGACAGAATATAAAGCAGGGG + Intronic
1103844787 12:123893728-123893750 CATGCCAGCCTTTAGAGCAGAGG + Intronic
1104350305 12:128039417-128039439 CATGTGAGCTGATAAATCAGGGG - Intergenic
1105442333 13:20425797-20425819 CATAACAGTTCATAATGCAGTGG + Intronic
1106380900 13:29238053-29238075 CATGACAGGGTATATACCAGAGG + Intronic
1106408954 13:29497663-29497685 CATGTCAGCTTAAAAAGTTGCGG - Intronic
1106765607 13:32910664-32910686 TACGACAGCTTATAAGGAAGTGG - Intergenic
1107668426 13:42716974-42716996 TATGGCAGACTATAAAGCAGTGG + Intergenic
1107736927 13:43408578-43408600 CATGACACCTGAGCAAGCAGTGG + Intronic
1107926348 13:45266113-45266135 CATGCCAGCTTAAAAAGCAGTGG - Intronic
1108122472 13:47204241-47204263 CATGACTGCTTGAAAAGCATGGG + Intergenic
1109314342 13:60732628-60732650 CTTCACAGATAATAAAGCAGAGG + Intergenic
1110829824 13:80018289-80018311 AAAGAGAGGTTATAAAGCAGAGG - Intergenic
1111426453 13:88090804-88090826 CAATAAAACTTATAAAGCAGGGG - Intergenic
1112850700 13:103702492-103702514 CCTGACAGCTTTTACAGAAGTGG + Intergenic
1113254167 13:108488457-108488479 AATAAGAGCTTAAAAAGCAGGGG + Intergenic
1115787587 14:36843357-36843379 CATGACAGCTGACAATTCAGGGG + Intronic
1115845774 14:37531874-37531896 GATGACAGCTTATAGAGCAGAGG - Intronic
1118719596 14:68584709-68584731 CAATACAGGTGATAAAGCAGGGG - Intronic
1118746429 14:68776839-68776861 CATGGCAGGTTATATAACAGAGG - Intergenic
1120526058 14:85578523-85578545 GAAGTCAGCTTATAAATCAGAGG + Intronic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1126306670 15:47266519-47266541 CATTACGGCTTATAAGGCAGTGG - Intronic
1128406332 15:67343615-67343637 CATGACTGATTATACAACAGGGG + Intronic
1130838291 15:87673081-87673103 CATGCCATCCTATAAATCAGTGG - Intergenic
1132250198 15:100330277-100330299 CATGGCAAGTTTTAAAGCAGTGG + Intronic
1135644151 16:24146683-24146705 GATGACAGCAAATAAAACAGAGG - Intronic
1137374321 16:47939829-47939851 AATCACAGCTGACAAAGCAGGGG - Intergenic
1139073338 16:63412076-63412098 CATGACATATTTTAAGGCAGTGG + Intergenic
1139213458 16:65104198-65104220 CATGACACCTTCATAAGCAGAGG + Intronic
1139783609 16:69372347-69372369 AATGACAGCCTAAAAAGGAGGGG + Exonic
1140310651 16:73845040-73845062 CATGGCTGCTTATAAAAAAGAGG - Intergenic
1140855467 16:78974307-78974329 CAGTACAGATAATAAAGCAGGGG + Intronic
1144090822 17:11854635-11854657 CACCACAGCTTGTAAACCAGTGG - Intronic
1144762938 17:17717578-17717600 GATGACAGCAGATAAAGGAGAGG - Intronic
1146472820 17:33138261-33138283 CATGACAACTCCTGAAGCAGTGG - Intronic
1148235023 17:45963055-45963077 CCTGTTAGCTTATAAATCAGTGG + Intronic
1149152397 17:53583661-53583683 CATGAAATATTATATAGCAGTGG + Intergenic
1152403616 17:80083890-80083912 CATTACAGCTTACAGAGCACAGG + Intronic
1153578257 18:6544547-6544569 AATGACTGCATAAAAAGCAGGGG + Intronic
1153760194 18:8323393-8323415 CATCATAACTTAGAAAGCAGGGG - Intronic
1154423323 18:14253017-14253039 CCTGACAGCTGATGGAGCAGAGG + Intergenic
1158876215 18:61736930-61736952 CAAGAAAGCTTATAATGCATGGG - Intergenic
1159434854 18:68403062-68403084 CATGACAACTAATAAAGTAAGGG + Intergenic
1161494173 19:4578701-4578723 CATGGAAGGTTATAGAGCAGGGG - Intergenic
1162536563 19:11265934-11265956 CCTGACAGCTGATCAAACAGAGG + Intergenic
925001763 2:408803-408825 CATGTCAGCTTATGATGCCGTGG + Intergenic
925686891 2:6482077-6482099 GATAGCAGCTTGTAAAGCAGGGG - Intergenic
928666864 2:33558344-33558366 CATGGCAGCAAAGAAAGCAGAGG - Intronic
929061411 2:37928418-37928440 AATCACAGGATATAAAGCAGAGG + Intronic
929326605 2:40619429-40619451 CAAGAAAACTGATAAAGCAGTGG - Intergenic
931127191 2:59291385-59291407 CATGTAAGCTTTTAAAGAAGAGG + Intergenic
932134089 2:69213555-69213577 CATGACAGCTTACAAAGAAGAGG - Intronic
935126708 2:100230809-100230831 CATGGCAGCATTTAAAGCTGTGG - Intergenic
939706266 2:145457465-145457487 CATAACAGTTGGTAAAGCAGGGG - Intergenic
940411549 2:153369899-153369921 CATGAGAGATTATGAACCAGAGG + Intergenic
943793036 2:191956579-191956601 CATGAAAGCATAAAAAGCACTGG - Intronic
944001083 2:194839005-194839027 CACTACATCTTATAAAACAGGGG - Intergenic
944054406 2:195508543-195508565 CCTGACAGCTGAAAAAGCTGGGG - Intergenic
948050849 2:234978343-234978365 CCTGACAGCCTGTACAGCAGTGG + Intronic
1169017181 20:2301412-2301434 CATGACAGGTCAGAAAGCTGAGG - Intronic
1171231969 20:23493988-23494010 CATGGCAGTGCATAAAGCAGTGG - Intronic
1173313603 20:41923197-41923219 CATGAAATCTTAGCAAGCAGAGG - Intergenic
1174991197 20:55512139-55512161 CATAAAAGCTGATAAAGCAGTGG - Intergenic
1175043364 20:56077430-56077452 CCTTACAGCTTTTAAAGCCGAGG - Intergenic
1181816202 22:25438448-25438470 CAAGAAAACATATAAAGCAGTGG + Intergenic
1182994121 22:34797308-34797330 CATGAGGGCTTATAAAGGGGAGG + Intergenic
1183502122 22:38186889-38186911 CATGAGAGGTTTTTAAGCAGAGG + Intronic
1184618296 22:45653373-45653395 CATCACAGCACAGAAAGCAGGGG - Intergenic
952258690 3:31717828-31717850 TGTGACAGTTTTTAAAGCAGAGG - Intronic
954190339 3:48955402-48955424 CAAGACAACTTATAAAGAAAAGG - Intronic
955887625 3:63617806-63617828 CATGACAGCTTATAAAGCAGAGG - Intergenic
956139662 3:66132867-66132889 AATGATAGCATATAAAACAGTGG - Intergenic
956859245 3:73306179-73306201 CATGACAGATTATAAAACTCAGG + Intergenic
957992466 3:87644754-87644776 CCTGATAGCATATAGAGCAGGGG + Intergenic
958815030 3:98905097-98905119 AATGACATCTTATGAGGCAGTGG + Intergenic
961587758 3:127948002-127948024 CATGACATCTTATAAAGAAGTGG + Intronic
961626393 3:128266718-128266740 CATGACAGCAGGTAAAGGAGGGG - Intronic
962263572 3:133929811-133929833 CATGGCAGCTTATAATGAAATGG + Exonic
963554204 3:146766311-146766333 CATGTCACCCAATAAAGCAGAGG - Intergenic
964070684 3:152629239-152629261 CCTTAAAGCATATAAAGCAGTGG - Intergenic
966114086 3:176440315-176440337 CTTGACTACTTATACAGCAGAGG - Intergenic
966943484 3:184761417-184761439 CAAGGGAGCTTATAGAGCAGAGG + Intergenic
969377416 4:6771932-6771954 CAAGGGAGGTTATAAAGCAGGGG + Intergenic
969675403 4:8611660-8611682 CTTGACAGTTTATAAAGCCCAGG - Intronic
969878347 4:10152706-10152728 CATGGCTGCTTATTGAGCAGAGG - Intergenic
970050253 4:11906122-11906144 GATGACAGATGATAAAGAAGAGG - Intergenic
970275278 4:14393141-14393163 CATGAAAGCAAATAAAACAGAGG + Intergenic
973885196 4:55313918-55313940 CATCACAGCTCCTAAGGCAGGGG + Intergenic
974773393 4:66446087-66446109 CCTGACAGATTAGATAGCAGAGG + Intergenic
975473514 4:74795847-74795869 CATGACAGCTCATAAAACATTGG + Intergenic
975579306 4:75892335-75892357 CCTGACAGGTTATAATGCGGGGG + Intronic
976336653 4:83895618-83895640 CATGATAGATTAAAAAGTAGAGG - Intergenic
978668542 4:111216568-111216590 CAAGACAGCTAATAAAACATGGG - Intergenic
979410541 4:120373241-120373263 CCTGAATGCTTATAATGCAGAGG - Intergenic
981251361 4:142605753-142605775 CAAGACAGGTGATAATGCAGAGG + Intronic
982127654 4:152198366-152198388 CATGGAATCTTATAAAGTAGAGG + Intergenic
984934426 4:184877932-184877954 CTTCACAGTTTATAAGGCAGGGG + Intergenic
986807445 5:11321843-11321865 CATGTCTGATTCTAAAGCAGAGG + Intronic
988657963 5:33233426-33233448 CATGGCAACTTATAAAAGAGAGG + Intergenic
989010102 5:36861376-36861398 CTGAATAGCTTATAAAGCAGGGG + Intergenic
991142971 5:63268069-63268091 CAGCACAGTTAATAAAGCAGTGG - Intergenic
991926335 5:71708776-71708798 CATGACAGATTTTAAAGCAGAGG + Intergenic
992636179 5:78727798-78727820 CATACCATCTTCTAAAGCAGTGG - Intronic
993425267 5:87755857-87755879 AATGAAAGCTTATGAAACAGAGG - Intergenic
999207305 5:149858664-149858686 CATCTCAGCTTACCAAGCAGCGG - Exonic
999919311 5:156301411-156301433 CAACAAAGGTTATAAAGCAGGGG - Intronic
1000127982 5:158266054-158266076 CATGACAGCTGCAAAAGCAATGG + Intergenic
1000668445 5:164028250-164028272 CATAAGAGATTAAAAAGCAGAGG - Intergenic
1002153585 5:177257096-177257118 CATGACAGGTTATACAGATGTGG - Exonic
1002307240 5:178291036-178291058 CTGGACAGCTGATAACGCAGAGG + Intronic
1005582260 6:27246510-27246532 CATGACAGTATATACAACAGGGG + Intergenic
1006583434 6:35089704-35089726 CAGGAAAGCTTAAGAAGCAGAGG - Exonic
1006839009 6:37016128-37016150 CATGAAAGTTTTTGAAGCAGTGG - Intronic
1007742150 6:44018887-44018909 CATAAAAGCATATACAGCAGGGG - Intergenic
1009294385 6:61926787-61926809 AATGACAGCTAGTAGAGCAGAGG + Intronic
1010663426 6:78598188-78598210 CCTGAGAGCTTCAAAAGCAGTGG + Intergenic
1014859886 6:126452948-126452970 CATGACAGGCCATAAAGAAGTGG + Intergenic
1015609151 6:134996388-134996410 CATGTCAGCTTACAAAGGAAAGG - Intronic
1016926798 6:149358824-149358846 CAGCAGAGCTTATAAAGCAATGG - Intronic
1017338529 6:153290986-153291008 CATGACACCTTACACAGCTGTGG + Intergenic
1017396064 6:154001640-154001662 CATGGCAGAGTTTAAAGCAGGGG + Intergenic
1022026147 7:26449587-26449609 CACGGCAGCTTTTAAATCAGAGG - Intergenic
1022112949 7:27242761-27242783 GATGACAGCTTAGAAAGAAGAGG + Exonic
1026286199 7:68965137-68965159 CATGACAGTTTACAAAGCCATGG + Intergenic
1030671447 7:112342260-112342282 CATGATAGATGATCAAGCAGAGG + Intronic
1030973119 7:116086578-116086600 CATTACAGCTTGGAAAACAGTGG - Intronic
1035842545 8:2828045-2828067 CATTTCAGCTTTTAAGGCAGGGG + Intergenic
1039378693 8:37063907-37063929 CAAGAAAGCTGATAAAGCAGTGG - Intergenic
1041173539 8:55170234-55170256 CACGTTAGCTTATAAAGCAAAGG + Intronic
1042594418 8:70430594-70430616 CATGACAGCCAATGAGGCAGTGG - Intergenic
1044578590 8:93798995-93799017 CATAACACCTTTTAAAGCTGAGG - Intronic
1046912476 8:119644270-119644292 CATGACAGCTTACACAGAGGAGG + Intronic
1047193050 8:122696003-122696025 AGTGACATCTTATAAAGCTGTGG - Intergenic
1047925270 8:129676692-129676714 CATGACAGATTGTAAGGGAGAGG + Intergenic
1047948155 8:129903645-129903667 CATCATAGCTTATGAAGCAAAGG + Intronic
1048901714 8:139044291-139044313 GATGGCAGCTTATAGAGCAATGG + Intergenic
1055794666 9:79962780-79962802 CATGACACCTTATACAAAAGAGG - Intergenic
1056076610 9:83048051-83048073 CCTCCCAGCATATAAAGCAGAGG + Intronic
1057228038 9:93302733-93302755 CAGGACAGGGAATAAAGCAGTGG + Intronic
1058089310 9:100786200-100786222 CCTGACACCTTACAAACCAGAGG + Intergenic
1059772104 9:117436437-117436459 CATGACAGGTGAGAAAGCAGTGG + Intergenic
1060400343 9:123345036-123345058 CATGACAGCCTATATAGAATAGG + Intergenic
1187131226 X:16504980-16505002 CTTGACAGCATAAAAAGCAATGG + Intergenic
1187902051 X:24034610-24034632 GATGACAGCTTATAGAGTGGAGG + Intergenic
1188583712 X:31747423-31747445 TATGACAGCTTTTAAAGGAAGGG + Intronic
1190853943 X:54274641-54274663 GATGACTGATTATAAAGCTGGGG + Intronic
1200909648 Y:8518605-8518627 CATGTCAGCCAATGAAGCAGAGG - Intergenic
1200954810 Y:8932331-8932353 CATGTCAGCCAATAAAGCAGAGG - Intergenic
1200958643 Y:8974986-8975008 CATGTCAGCCAATAAAGCAGAGG - Intergenic
1202232954 Y:22673722-22673744 CATGTCAGCCAATAAAGCAGAGG - Intergenic
1202310202 Y:23522436-23522458 CATGTCAGCCAATAAAGCAGAGG + Intergenic
1202560599 Y:26148157-26148179 CATGTCAGCCAATAAAGCAGAGG - Intergenic