ID: 955894805

View in Genome Browser
Species Human (GRCh38)
Location 3:63687752-63687774
Sequence TTTGTCTTGAATTTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955894805_955894808 28 Left 955894805 3:63687752-63687774 CCAGGCAGAAAATTCAAGACAAA No data
Right 955894808 3:63687803-63687825 CTTTAGTTAAGCAGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955894805 Original CRISPR TTTGTCTTGAATTTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr