ID: 955895013

View in Genome Browser
Species Human (GRCh38)
Location 3:63689605-63689627
Sequence AGTAATTATCACTAGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955895011_955895013 24 Left 955895011 3:63689558-63689580 CCATTGTTCATTTGTATATTCAG No data
Right 955895013 3:63689605-63689627 AGTAATTATCACTAGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955895013 Original CRISPR AGTAATTATCACTAGGTTTC AGG Intergenic
No off target data available for this crispr