ID: 955896674

View in Genome Browser
Species Human (GRCh38)
Location 3:63707742-63707764
Sequence CCAAGTGAACTGTCAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955896674_955896682 12 Left 955896674 3:63707742-63707764 CCTCTCCCTGACAGTTCACTTGG No data
Right 955896682 3:63707777-63707799 TTCAGACATTTGCAAAGGATGGG No data
955896674_955896681 11 Left 955896674 3:63707742-63707764 CCTCTCCCTGACAGTTCACTTGG No data
Right 955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG No data
955896674_955896680 7 Left 955896674 3:63707742-63707764 CCTCTCCCTGACAGTTCACTTGG No data
Right 955896680 3:63707772-63707794 CTGGCTTCAGACATTTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955896674 Original CRISPR CCAAGTGAACTGTCAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr