ID: 955896676

View in Genome Browser
Species Human (GRCh38)
Location 3:63707747-63707769
Sequence ATTTTCCAAGTGAACTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955896676_955896680 2 Left 955896676 3:63707747-63707769 CCCTGACAGTTCACTTGGAAAAT No data
Right 955896680 3:63707772-63707794 CTGGCTTCAGACATTTGCAAAGG No data
955896676_955896681 6 Left 955896676 3:63707747-63707769 CCCTGACAGTTCACTTGGAAAAT No data
Right 955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG No data
955896676_955896682 7 Left 955896676 3:63707747-63707769 CCCTGACAGTTCACTTGGAAAAT No data
Right 955896682 3:63707777-63707799 TTCAGACATTTGCAAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955896676 Original CRISPR ATTTTCCAAGTGAACTGTCA GGG (reversed) Intergenic