ID: 955896677

View in Genome Browser
Species Human (GRCh38)
Location 3:63707748-63707770
Sequence CATTTTCCAAGTGAACTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955896677_955896680 1 Left 955896677 3:63707748-63707770 CCTGACAGTTCACTTGGAAAATG No data
Right 955896680 3:63707772-63707794 CTGGCTTCAGACATTTGCAAAGG No data
955896677_955896681 5 Left 955896677 3:63707748-63707770 CCTGACAGTTCACTTGGAAAATG No data
Right 955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG No data
955896677_955896682 6 Left 955896677 3:63707748-63707770 CCTGACAGTTCACTTGGAAAATG No data
Right 955896682 3:63707777-63707799 TTCAGACATTTGCAAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955896677 Original CRISPR CATTTTCCAAGTGAACTGTC AGG (reversed) Intergenic
No off target data available for this crispr