ID: 955896681

View in Genome Browser
Species Human (GRCh38)
Location 3:63707776-63707798
Sequence CTTCAGACATTTGCAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955896674_955896681 11 Left 955896674 3:63707742-63707764 CCTCTCCCTGACAGTTCACTTGG No data
Right 955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG No data
955896676_955896681 6 Left 955896676 3:63707747-63707769 CCCTGACAGTTCACTTGGAAAAT No data
Right 955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG No data
955896677_955896681 5 Left 955896677 3:63707748-63707770 CCTGACAGTTCACTTGGAAAATG No data
Right 955896681 3:63707776-63707798 CTTCAGACATTTGCAAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955896681 Original CRISPR CTTCAGACATTTGCAAAGGA TGG Intergenic
No off target data available for this crispr