ID: 955896682

View in Genome Browser
Species Human (GRCh38)
Location 3:63707777-63707799
Sequence TTCAGACATTTGCAAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955896677_955896682 6 Left 955896677 3:63707748-63707770 CCTGACAGTTCACTTGGAAAATG No data
Right 955896682 3:63707777-63707799 TTCAGACATTTGCAAAGGATGGG No data
955896674_955896682 12 Left 955896674 3:63707742-63707764 CCTCTCCCTGACAGTTCACTTGG No data
Right 955896682 3:63707777-63707799 TTCAGACATTTGCAAAGGATGGG No data
955896676_955896682 7 Left 955896676 3:63707747-63707769 CCCTGACAGTTCACTTGGAAAAT No data
Right 955896682 3:63707777-63707799 TTCAGACATTTGCAAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955896682 Original CRISPR TTCAGACATTTGCAAAGGAT GGG Intergenic