ID: 955900979

View in Genome Browser
Species Human (GRCh38)
Location 3:63754091-63754113
Sequence TTCACCCTGAACTGCCACGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955900979 Original CRISPR TTCACCCTGAACTGCCACGA CGG (reversed) Intergenic
907908090 1:58803039-58803061 CTGACCCTGAACTTCCACGTGGG - Intergenic
909391857 1:75129258-75129280 TAAACCCTGAACTCCCATGAAGG + Intronic
921221210 1:212975306-212975328 TTCAGCAGGTACTGCCACGAGGG + Intronic
1063107188 10:3002702-3002724 TGCTCCCTGAACTGCCACACAGG - Intergenic
1065583053 10:27190925-27190947 TGCACCCTGAACTGGAATGAGGG + Intergenic
1073127660 10:101161906-101161928 ATCACCCTGAATGGCCACAAGGG + Intergenic
1073494264 10:103877264-103877286 TTAAACCTGAAATACCACGAAGG - Intergenic
1074505524 10:114067120-114067142 TTCATCCTGAACGGCCCCGACGG - Intergenic
1075703633 10:124485150-124485172 GTCACCCTTAACTGGCACCAGGG - Intronic
1078079555 11:8193945-8193967 TTCCACCTGCACTGCCAAGATGG + Intergenic
1078235254 11:9478483-9478505 ATCAGCCTGAATTGCCAAGATGG - Exonic
1079082501 11:17423727-17423749 TCCTCCCAGAACTGCCACGTGGG - Intronic
1080429603 11:32186025-32186047 TTCACCCTGATCTGCTCAGATGG + Intergenic
1083377585 11:62238260-62238282 TTCACCCTCAACTGCCCACAGGG + Intergenic
1084490653 11:69476534-69476556 TTCACCCCGAACTTCCCCCATGG + Intergenic
1086186825 11:84027790-84027812 ATCACTCTGAACTGCCATGAAGG - Intronic
1091412626 12:254130-254152 TCCACCCTCAGCTGCCAGGAGGG - Intronic
1093434071 12:19115484-19115506 TTCAACCTGAACAGCCACACAGG + Intergenic
1095508248 12:42921360-42921382 TTCAGCCTCAACTGCCTCCATGG + Intergenic
1099871252 12:88352053-88352075 TTCACCCTTCATTGCCCCGATGG + Intergenic
1108535692 13:51374693-51374715 TTGATCCTGATCAGCCACGAAGG - Exonic
1112083560 13:96003700-96003722 ATCAGCCTGAACTGCCACACAGG + Intronic
1122178715 14:99939310-99939332 TTTACCCTGAACTGCGAGCAGGG - Exonic
1122843633 14:104478769-104478791 TGCTCCCTGGACTGCCATGATGG - Intronic
1131073926 15:89483154-89483176 TTTACCCAGAACTGCCCCAAAGG + Exonic
1139339815 16:66261107-66261129 ATCACCCTCACCTGCCACCACGG + Intergenic
1143765599 17:9135582-9135604 TTCCCCTTGAATTGTCACGATGG + Intronic
1147675901 17:42205404-42205426 TTCACCCTGAACTCCAAGGCTGG + Intronic
1151260006 17:72908752-72908774 TTCACCCCAAACTGCCAGGGTGG + Intronic
1159941650 18:74413055-74413077 TTCACCCTGGACCCCCAGGAGGG + Intergenic
1163222394 19:15930944-15930966 TTCACCCTCCACTGCACCGATGG + Intronic
1165073697 19:33269493-33269515 GTCACCCTGCACTCCCTCGAGGG - Intergenic
926944464 2:18171654-18171676 TCCACCCTGAACAGCCAAGAGGG - Intronic
930819531 2:55631787-55631809 GGCACCCTGAACTGCCAGGATGG - Intergenic
932573652 2:72951149-72951171 ATCACCCTGCCCTGCCATGAAGG + Intronic
933048104 2:77564730-77564752 GTTACCCTGAACTGCCTTGATGG - Intronic
933492289 2:83001338-83001360 TTGACCCTGAACAGCCAAGAGGG - Intergenic
936074002 2:109390177-109390199 TTCTCCAAGAACTGCCACAAGGG - Intronic
936706192 2:115077361-115077383 TTCACCATGAACTTCAAAGAGGG + Intronic
939873375 2:147549496-147549518 ATCACCCTGAGCTACCACCAAGG + Intergenic
1169797827 20:9483980-9484002 CTTACCCTGAACTTCCAAGAAGG - Intergenic
1175421701 20:58838987-58839009 GTCACCCTGAACTGCCCCGCAGG + Intergenic
1179727205 21:43347240-43347262 CTCACCCCCAACTGCCACCAAGG + Intergenic
955900979 3:63754091-63754113 TTCACCCTGAACTGCCACGACGG - Intergenic
963234446 3:142943080-142943102 TTCACCCTGTTTTGCCAGGATGG - Intergenic
966746155 3:183279530-183279552 TTCACCCTGAATTGCCCCTAGGG + Intronic
976539852 4:86261881-86261903 TTCACCATGCACTGCCGTGAGGG + Intronic
990903047 5:60773880-60773902 TTCATCATGAATTGCCACGATGG + Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1001808455 5:174609022-174609044 GTAACTCTGCACTGCCACGAAGG + Intergenic
1003571364 6:7258537-7258559 TCCACCCTGAACTGGGAGGAAGG - Intergenic
1005734476 6:28732684-28732706 TTCACCCTGAAATTCCTCGTTGG - Intergenic
1011750335 6:90448918-90448940 TTCTCCCAGAACTGCCAAGAAGG - Intergenic
1017015597 6:150097015-150097037 GACACGCTGAACTGCCACTAAGG - Intergenic
1019815030 7:3193374-3193396 TTCACCCTGAGATGCCACATGGG + Intergenic
1023104174 7:36747278-36747300 TTCACCCTAGGCTGCCAGGAAGG + Intergenic
1026451400 7:70532624-70532646 TGCCCCCTGAACAGCCACGTAGG - Intronic
1027903513 7:84149911-84149933 CTCACATTGAACTGCCACGAAGG - Intronic
1028670037 7:93391579-93391601 TACACCCTGAAATGTCATGATGG + Intergenic
1029156072 7:98518848-98518870 TTCATCCTAAACTTCCTCGAAGG + Intergenic
1035344715 7:158190598-158190620 GTGACCCTGTACTTCCACGAGGG + Intronic
1037035911 8:14166505-14166527 TTAACCCTGAACTGCCTGAAAGG + Intronic
1039981936 8:42415418-42415440 TTCTCCCAGAACTGCCACTGAGG + Intergenic
1040414584 8:47184836-47184858 TCCACCCTGTAGTGCCATGAAGG - Intergenic
1040415784 8:47194221-47194243 TTCAGCCTGAACTGCCACTTTGG + Intergenic
1041016908 8:53600194-53600216 TTCCTCCTGTACTGCCACCATGG - Intergenic
1042782394 8:72506207-72506229 TGCACCCTGAGCTGCCAGGATGG + Intergenic
1047522282 8:125604237-125604259 TTCAGCCTGGGCTGCCACAAGGG - Intergenic
1057128194 9:92635437-92635459 TGCACCCTGGACTGGCACTAAGG + Intronic
1059904511 9:118967384-118967406 GTCAGGCTGAACTGCCACAAAGG - Intergenic
1061910126 9:133717883-133717905 TTCACCCAGACCTGGCACGCTGG + Intronic