ID: 955905799

View in Genome Browser
Species Human (GRCh38)
Location 3:63806326-63806348
Sequence ATCCCAGGAAACACCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955905799_955905804 30 Left 955905799 3:63806326-63806348 CCACTCTGGGTGTTTCCTGGGAT No data
Right 955905804 3:63806379-63806401 TGGAACCCTTCCCTTAGTGTTGG No data
955905799_955905803 10 Left 955905799 3:63806326-63806348 CCACTCTGGGTGTTTCCTGGGAT No data
Right 955905803 3:63806359-63806381 GTTAATTACAGTACTTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955905799 Original CRISPR ATCCCAGGAAACACCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr