ID: 955909168

View in Genome Browser
Species Human (GRCh38)
Location 3:63842688-63842710
Sequence GAGATTAAGAAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955909163_955909168 9 Left 955909163 3:63842656-63842678 CCAAAACATACAGAGTGACATAA 0: 1
1: 1
2: 4
3: 27
4: 272
Right 955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG 0: 1
1: 0
2: 6
3: 36
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955909168 Original CRISPR GAGATTAAGAAGATGGAGGC TGG Intronic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
902778059 1:18687184-18687206 GAGATAAAGATGATGGGGCCTGG - Intronic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904670430 1:32160858-32160880 GAGATTGAGAAGGTTGTGGCCGG + Intronic
904682306 1:32237842-32237864 GAGATTTAGAAGATTGTGGCTGG - Intergenic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
906268370 1:44452766-44452788 GATAATAAGAAGGTAGAGGCTGG - Intronic
907646829 1:56252721-56252743 GAGACAAAGAAGATGGGGCCTGG + Intergenic
907733698 1:57091620-57091642 GAGGTTAAGAACATGGACACTGG + Intronic
908100553 1:60786595-60786617 GGGATTGGGAAGCTGGAGGCAGG + Intergenic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
908702178 1:66913684-66913706 CACAGTAAGAAGGTGGAGGCCGG + Intronic
908755592 1:67466383-67466405 CAGATTATGATGATGAAGGCTGG + Intergenic
909012338 1:70348564-70348586 AAGATTAAAAAGGTGCAGGCTGG - Intronic
909096361 1:71293173-71293195 GAGAGAAAGAAGAGGGAGGGAGG - Intergenic
909931213 1:81502353-81502375 GTGATGATGCAGATGGAGGCCGG + Intronic
910951289 1:92651553-92651575 GATATTAAGAAATTGGGGGCCGG + Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
911577232 1:99593042-99593064 GAGATTTAGAAAACTGAGGCTGG + Intergenic
911706442 1:101018802-101018824 GGGATAAAGAAGTGGGAGGCAGG + Intronic
912436118 1:109662126-109662148 GAGATCAAGAAGTTGGAAACAGG - Intronic
913435920 1:118847653-118847675 GAGATTAAGAACACCGAGACTGG + Intergenic
913660374 1:121001704-121001726 GAGTTTAAGAGGATGCAGGATGG - Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914650365 1:149693520-149693542 GAGTTTAAGAGGATGCAGGATGG - Intergenic
915231125 1:154446055-154446077 AAGACAAAGAAGATGGGGGCAGG - Intronic
915622491 1:157094323-157094345 GAGACAGAGAAGAAGGAGGCTGG - Intronic
915890902 1:159772876-159772898 GAAATTAAGAGGATGGGGGTGGG - Intergenic
915915727 1:159939518-159939540 AAGATTAAGAAAATGCAGCCAGG - Intronic
916160183 1:161903806-161903828 GAGATTAAAAGGATGGACTCTGG - Intronic
916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG + Intronic
916952981 1:169799968-169799990 GCACTTTAGAAGATGGAGGCAGG - Intronic
917737093 1:177931407-177931429 GAGATTCAGAAGAGGAAGGGTGG + Intronic
918694566 1:187528516-187528538 AAGCTTAAAAAGATGCAGGCAGG + Intergenic
918873534 1:190008592-190008614 GAGCTTCAGAAGACCGAGGCAGG - Intergenic
921052011 1:211517535-211517557 GAGAGAAAGAAGAGTGAGGCTGG - Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922743049 1:228026613-228026635 GAGACTCAGAAGAGGGAGGTTGG - Intronic
922972080 1:229750759-229750781 GGGTTTAGGAAGCTGGAGGCTGG - Intergenic
923881033 1:238104419-238104441 GATAAAAAGAAAATGGAGGCTGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063210639 10:3877938-3877960 GAGATTAAGCAACTGCAGGCTGG - Intergenic
1063790738 10:9443267-9443289 ATGATAAAGAAGCTGGAGGCAGG - Intergenic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064506647 10:16038166-16038188 GAGACTCAGAAGAGGAAGGCTGG + Intergenic
1067257723 10:44660775-44660797 GAAATTAACCAGAGGGAGGCGGG + Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1069934895 10:71908507-71908529 GAGATTAAAAGGATGGGGACGGG + Intergenic
1070224946 10:74494224-74494246 GTGATTAAAAATATGGAGGTAGG - Intronic
1070264148 10:74886341-74886363 AAGATTGGGAAGCTGGAGGCAGG + Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070471201 10:76781404-76781426 GAAAAGAAGAAGCTGGAGGCCGG - Intergenic
1070516010 10:77207324-77207346 GAGGTTAAGAAAATGGACTCTGG + Intronic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1072282426 10:93879055-93879077 GAGATTAGGAGGATGGAAGGAGG + Intergenic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1074709704 10:116167097-116167119 GAGATTAAGAAGATTGTGGTGGG - Intronic
1074794113 10:116923845-116923867 ACGATTAAGAAACTGGAGGCTGG - Intronic
1074905509 10:117859846-117859868 GAGATTGAGAGGCTGGAGACAGG - Intergenic
1075402319 10:122170185-122170207 GAGATGAGGAAGATGGGGGTGGG - Intronic
1076185906 10:128448567-128448589 CTGATAATGAAGATGGAGGCAGG + Intergenic
1076289067 10:129330126-129330148 GAGAGTGAGAACATGGAGGAGGG + Intergenic
1076331732 10:129675309-129675331 GAGGTTAGGCAGATGCAGGCAGG + Intronic
1076544887 10:131238590-131238612 GAGATAATGAACATGGAGGAAGG - Intronic
1077223615 11:1428089-1428111 AAGTGAAAGAAGATGGAGGCAGG + Intronic
1077871431 11:6265535-6265557 AAGATTAAAGAGGTGGAGGCTGG + Intronic
1078239540 11:9518414-9518436 GTCATTAAGAAAATGCAGGCTGG + Intronic
1078678689 11:13453755-13453777 TACATTAAGAAGAAAGAGGCTGG + Intronic
1078758235 11:14231433-14231455 GCCATTAAAAAAATGGAGGCTGG - Intronic
1079649858 11:22914191-22914213 GAATTTAAGAAAATGGAGGTAGG - Intergenic
1080061793 11:27964209-27964231 GACATTAAGAAGATCAAGGCAGG + Intergenic
1080147210 11:29000978-29001000 GAGTTTAAGAAGAATGAGTCAGG - Intergenic
1080281953 11:30567516-30567538 GAGAATAAGAAACTGGAGGGAGG - Intronic
1081503159 11:43687239-43687261 GAGATTAAGGTTAGGGAGGCAGG + Intronic
1081657652 11:44868093-44868115 GAGATGGAGAAAAAGGAGGCCGG + Intronic
1082711533 11:56559221-56559243 GAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1082763510 11:57148595-57148617 GAAATTCAGAAAATGGAGGAGGG + Intergenic
1083154198 11:60812539-60812561 GAAATTAAGAAGGTAGGGGCCGG + Intergenic
1083434425 11:62632968-62632990 GACATCAGGAAGATGGAGGTGGG - Intronic
1083493871 11:63033625-63033647 TGGATTAAGAACCTGGAGGCTGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085081790 11:73641067-73641089 GAGATAAAGAATAAAGAGGCTGG + Intergenic
1085939445 11:81191284-81191306 GGTCTTAAGGAGATGGAGGCAGG + Intergenic
1086346935 11:85906361-85906383 GAGATTAAGTGAATTGAGGCTGG - Intronic
1086384726 11:86295487-86295509 GAGAAAAAGAAGATGAAGACAGG + Intergenic
1087561242 11:99793352-99793374 AAAATTAAGAAGATAGAGCCGGG - Intronic
1087816738 11:102666164-102666186 GAGACTAACATTATGGAGGCAGG + Intergenic
1089292728 11:117448068-117448090 GACATGAAGAAGATGGAGGGAGG + Intronic
1089909798 11:122085974-122085996 GAGTTTAAAAGAATGGAGGCCGG + Intergenic
1090055139 11:123417076-123417098 GATATTAAGAATGTGTAGGCAGG + Intergenic
1090480230 11:127061436-127061458 GGGATAAAGAAGATGGGTGCAGG - Intergenic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1091837562 12:3596297-3596319 GAGATCAAGGAGATCAAGGCAGG - Intergenic
1092173858 12:6390028-6390050 GAGAGAAAGAAGAGGGAGGGAGG + Intronic
1092308493 12:7325978-7326000 GAGAATAAGAACATGGTGGCAGG - Intronic
1092556129 12:9563821-9563843 GCTACTCAGAAGATGGAGGCAGG + Intergenic
1092630848 12:10374673-10374695 GATATTAAAAAGAATGAGGCCGG - Intronic
1092766390 12:11856653-11856675 GAGAGGAAGTAGCTGGAGGCAGG - Intronic
1092832185 12:12455299-12455321 CAGTTTAGGAATATGGAGGCTGG - Intronic
1092880428 12:12883879-12883901 GATAAAAACAAGATGGAGGCAGG + Intergenic
1092996470 12:13955856-13955878 AAGATCAAGAAGATGCAGCCTGG + Intronic
1093770808 12:23015511-23015533 GAGATTTAGGAGACTGAGGCAGG - Intergenic
1094627050 12:32134143-32134165 TAGATTAGGAACATGGAGACTGG + Intronic
1094753952 12:33444305-33444327 TAGGTTTAGAAGATGGAAGCTGG - Intergenic
1095298791 12:40558137-40558159 GAGATTACTATGATGGATGCAGG + Intronic
1095567303 12:43640506-43640528 GAGATAGAGAACATGGAGGAGGG - Intergenic
1096034723 12:48456512-48456534 GAGATTAAGATCATGGACTCTGG + Intergenic
1097288342 12:57894555-57894577 GAGGGTTAGAAGGTGGAGGCTGG + Intergenic
1097622408 12:61956368-61956390 GATTTTGAGAAGATGGAGGAAGG - Intronic
1099652619 12:85447761-85447783 GAGATGATGAAGATGTAGGTGGG + Intergenic
1099831730 12:87852250-87852272 GGGATAGAGAAGAGGGAGGCAGG + Intergenic
1100672054 12:96824186-96824208 GAGATGAAGAAGGGGAAGGCAGG - Intronic
1101523590 12:105507218-105507240 GAGATAAGGATGATGTAGGCTGG - Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102776719 12:115526123-115526145 GAGAAAAAGAAGATAGAGACAGG - Intergenic
1103200726 12:119085852-119085874 GAGAGAAAGAGGATGGAGGGTGG + Intronic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1104400635 12:128473119-128473141 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400640 12:128473167-128473189 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400677 12:128473503-128473525 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104400697 12:128473689-128473711 GTGAAGATGAAGATGGAGGCTGG - Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1105272381 13:18889987-18890009 GGCCTTAAGAAGAGGGAGGCAGG - Intergenic
1105395198 13:20025617-20025639 GAGATAAAGAATATGAGGGCAGG - Intronic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106929467 13:34648251-34648273 GAGAAGAAGAAGATGGGGGAGGG + Intergenic
1106949731 13:34870017-34870039 CAGAGTAAGAAGATACAGGCAGG + Intergenic
1108738995 13:53315146-53315168 GAGACTCAGAAGAGGGAGGGTGG + Intergenic
1109852693 13:68087707-68087729 GAGATTAAGAGTATGGACTCTGG + Intergenic
1110210941 13:72972326-72972348 TACTTTAAGAAAATGGAGGCAGG - Intronic
1112037433 13:95509777-95509799 GAGACAAAGACGATGGTGGCAGG - Intronic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1114649318 14:24273748-24273770 GTGATTAAGAACATGGATCCTGG + Intergenic
1115917250 14:38329708-38329730 GTGCTTATGAGGATGGAGGCTGG + Intergenic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1116018296 14:39432271-39432293 GAGTTTGAGAAGACAGAGGCTGG - Exonic
1117571625 14:57054781-57054803 GAAATTGAGAAGATGGAGAGAGG + Intergenic
1117673389 14:58130951-58130973 GAGATTAAGATGGTGGGGGGTGG - Intronic
1117845423 14:59906567-59906589 GAGAGTAAGAATATGAAGGGAGG - Intergenic
1118306619 14:64660420-64660442 GAGAGTAAGGAGGTGGATGCAGG - Intergenic
1120339002 14:83194837-83194859 TTAATTAAGAAGATGGAGGGAGG + Intergenic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1122878650 14:104680130-104680152 GAGAGTCAGAAGACGGAGGGGGG - Intergenic
1125675289 15:41498928-41498950 GAGATTGGGAGGCTGGAGGCAGG + Intronic
1125833627 15:42732768-42732790 AGGATGGAGAAGATGGAGGCTGG + Intronic
1126405713 15:48320618-48320640 GAGACTAAGAAGCTGGAGGCTGG - Intergenic
1126715863 15:51516792-51516814 GAGACTCAGAAGAGGGAGGGTGG - Intronic
1127449525 15:59103274-59103296 GAGACTCAGAAGAGGGAGGGTGG - Intergenic
1127754822 15:62081884-62081906 CAGAGTAAGATGATGGAGACTGG + Intergenic
1128610643 15:69070431-69070453 GAGAGAAAGAAAAGGGAGGCAGG + Intergenic
1129174086 15:73827406-73827428 GAGATAAAGGAGATGGTGGGAGG - Intergenic
1129291663 15:74572881-74572903 GTGATGATGCAGATGGAGGCCGG + Exonic
1129609851 15:77044532-77044554 GAGACCAAAAAGATGGAGGTGGG - Exonic
1130792518 15:87170622-87170644 AAGATTAAGAAAATGCAGGGAGG - Intergenic
1130967382 15:88707324-88707346 GAGATTCAGAAGAGGGAGCGTGG - Intergenic
1131145903 15:90011908-90011930 GATATTAAGAAGCTGGGGGCTGG + Intronic
1131320593 15:91386352-91386374 GAAAATAAGAAGATGGGGTCCGG + Intergenic
1132109255 15:99090269-99090291 GAAATTAAGAGCATGGAGGGTGG - Intergenic
1133244166 16:4436302-4436324 AAGATTGAAAAGATGGAGGCTGG + Intronic
1133375656 16:5284651-5284673 GAGAATCAGAAGACTGAGGCAGG - Intergenic
1134171916 16:11976106-11976128 GAGATTGAGGAGGTGGAGGGAGG - Intronic
1134278901 16:12801017-12801039 GAGAATAGGAAGTTGGGGGCGGG - Intronic
1135153580 16:20032192-20032214 AAGATGAAGAAGATGGAGCAGGG + Exonic
1135599591 16:23770850-23770872 GAGATTAGGAAGGTTGAGGCAGG - Intergenic
1135660372 16:24291497-24291519 GAGAGCAAGAAGATGGAGGTGGG + Intronic
1135730065 16:24886854-24886876 GAGGTTAAGGAGGTTGAGGCAGG + Intronic
1135973014 16:27086008-27086030 GAGACTCAGAAGGTGGAGGGTGG + Intergenic
1136080573 16:27849949-27849971 AAGATGAAGAAGATGAAGGGAGG + Intronic
1137043606 16:35637103-35637125 GAGACTAAGAAGCTGAAGGAGGG + Intergenic
1138270286 16:55691168-55691190 GAGAGCAAGAAGAGGGAGGGAGG + Intronic
1139414578 16:66797531-66797553 GAAAATAAGAAAATGGGGGCTGG - Intronic
1140997627 16:80276861-80276883 GTGATTAAGAAGATTGAGATGGG + Intergenic
1141275453 16:82583662-82583684 GAGATGAAGAGGATGGAGACAGG - Intergenic
1141980767 16:87548710-87548732 GAAAATAGAAAGATGGAGGCCGG + Intergenic
1142378416 16:89718508-89718530 GTGGATAAGAAGATGGAGACTGG - Intronic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1142689089 17:1594119-1594141 GAAATTCAGAAGCAGGAGGCCGG - Intronic
1142898335 17:2996371-2996393 GAAAATAAGAAAATGCAGGCAGG + Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1144825206 17:18101896-18101918 GAGATTGAGAAGGTGGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150006877 17:61475469-61475491 GAGAGAAAGTAGATGGAGGTAGG + Intronic
1150117248 17:62564100-62564122 AAGATTAAAAACATGTAGGCAGG + Intronic
1150245059 17:63668529-63668551 GAGATTGAGGGGATGGAGGTGGG + Intronic
1150601223 17:66652827-66652849 TAGAGTAAGAGGGTGGAGGCAGG - Intronic
1150645774 17:66976616-66976638 GATAGAAAGAAGATGAAGGCAGG - Intronic
1150647038 17:66985176-66985198 GAGACTAAGAAAATGCAGGTAGG - Intronic
1150727936 17:67666652-67666674 GAGATTGAGAAGAGGCAGGAGGG + Intronic
1151267489 17:72967995-72968017 GAGGTGGAGAAGAAGGAGGCTGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1152984704 18:311210-311232 GAGATGGAGAATATGGAGGAAGG + Intergenic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1154031287 18:10756271-10756293 GAGATGAAGAGGAGGGATGCAGG + Intronic
1154291574 18:13112642-13112664 GACACTAAGAAGATGAAGGAAGG - Intronic
1154464161 18:14627571-14627593 GGCCTTAAGAAGAGGGAGGCAGG - Intergenic
1155829128 18:30490088-30490110 GAGAAGAAGAAGCTGGAGTCTGG - Intergenic
1156193074 18:34742437-34742459 GAGGATTCGAAGATGGAGGCAGG - Intronic
1156590007 18:38476103-38476125 GAGGTAGAGAAGATGGAGGTAGG + Intergenic
1157673339 18:49549334-49549356 GAGATTGGGAAGACAGAGGCAGG + Intergenic
1158721782 18:59931625-59931647 GAGAATAAGAAGCTAGGGGCCGG - Intergenic
1158955444 18:62533568-62533590 AAGATTAAGTATATCGAGGCTGG + Intronic
1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG + Intronic
1160035733 18:75300030-75300052 GAGATTCAGAGGCTGAAGGCTGG + Intergenic
1160297006 18:77647986-77648008 AAGATTAAGAAGTGGGGGGCAGG + Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160448670 18:78947107-78947129 GAGAGGAAGAGGATGGAGGGAGG + Intergenic
1160448713 18:78947260-78947282 GAGAGGAAGAGGATGGAGGAGGG + Intergenic
1161914100 19:7216020-7216042 GTGGCTAAGAAGATGGAAGCAGG + Intronic
1162085119 19:8244060-8244082 AAAATGAAGAAGACGGAGGCAGG + Intronic
1162098008 19:8322194-8322216 GAGACTGACAAGAGGGAGGCGGG + Intronic
1165159717 19:33808809-33808831 GAGATAGAGAAGATGGAGCAAGG + Intronic
1165772792 19:38388537-38388559 GATCTTAAGAAAATGGGGGCTGG + Intronic
1165984905 19:39759461-39759483 GCTATTAAGAAGGTTGAGGCAGG - Intergenic
1166109647 19:40614221-40614243 GAGAGTCAGAAGGGGGAGGCCGG - Intronic
1166144411 19:40824247-40824269 AAGACTAAGCAGGTGGAGGCGGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167926185 19:52822774-52822796 GAGTTTTACAACATGGAGGCAGG + Intronic
1168689331 19:58367373-58367395 GAACATAAGACGATGGAGGCAGG - Intergenic
925015321 2:519939-519961 TAGACTGTGAAGATGGAGGCAGG + Intergenic
925381672 2:3431922-3431944 CAGATTAAAAAGATGGTGGTGGG - Intronic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926181352 2:10646637-10646659 GAAATTAAGATGATCAAGGCAGG + Intronic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926972642 2:18482265-18482287 GAAATTATGAAAATGGAGACAGG + Intergenic
928302677 2:30140467-30140489 GAGAATAAAAAGTTTGAGGCCGG + Intergenic
929825766 2:45308618-45308640 GTGATTAAGAATGTGGATGCTGG + Intergenic
930140523 2:47947234-47947256 AAGATTACGAAGATGGAAGGGGG - Intergenic
931085039 2:58820578-58820600 GAGGTTAAGAAGATGGGAGGAGG - Intergenic
931853112 2:66273847-66273869 GCCATTAGGAAGATGAAGGCAGG + Intergenic
932397889 2:71460653-71460675 CAGACTAGGAAGTTGGAGGCTGG + Intronic
932585808 2:73027955-73027977 AAGATTAAAAAGATGGGGCCAGG - Intronic
933043100 2:77494795-77494817 GAGATGAAGGAGATTGATGCAGG - Intronic
934213335 2:90005381-90005403 GACCTGAAGGAGATGGAGGCCGG - Intergenic
934896159 2:98121916-98121938 AAGATTCAGAATATGGATGCTGG - Intronic
938559894 2:132462583-132462605 GAGCTGTAGAAAATGGAGGCAGG - Intronic
939557859 2:143698538-143698560 TAGTTTGAGAAGATGGGGGCAGG + Intronic
940816782 2:158305640-158305662 GCTATTTGGAAGATGGAGGCAGG + Intronic
941119208 2:161508502-161508524 TAGATGAAGAAAATGTAGGCTGG - Intronic
941375106 2:164718797-164718819 GAAATGAAGAAGATGGAAGTGGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941473782 2:165923074-165923096 GAGACTTAGAAGAGGGAGGATGG + Intronic
943648060 2:190428967-190428989 GAAATAAAAAAGATTGAGGCTGG - Intronic
944204932 2:197148268-197148290 GGGATAAAGAAGAGTGAGGCCGG - Intronic
944782910 2:203038974-203038996 ACTATTAAGAAAATGGAGGCTGG - Intronic
947333645 2:229056866-229056888 GAGGTGAAGAAGAGAGAGGCAGG + Intronic
947783027 2:232787255-232787277 GAGAAGATGAAGATGGAGGTTGG + Exonic
1168837345 20:886023-886045 GAGAGGAGGAAGATGGGGGCAGG + Intronic
1169086983 20:2832788-2832810 GAAATTAAAAATATGGAGGTAGG + Intergenic
1169416577 20:5422348-5422370 GAGACTCAGAAGCTGGAGGGTGG + Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170797828 20:19565099-19565121 GAGAATGAGAGGATGGAAGCCGG - Intronic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1170950683 20:20933309-20933331 GAGATTAAGAAGCAGGAGGTTGG - Intergenic
1171329164 20:24322295-24322317 TAGATGAGGAAGCTGGAGGCTGG - Intergenic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1172153031 20:32803917-32803939 GACAATAACAGGATGGAGGCGGG + Intronic
1172371432 20:34395397-34395419 GAGAGAAAGAAGATTGAGGGAGG + Intronic
1172685833 20:36753708-36753730 ATCAATAAGAAGATGGAGGCTGG + Intronic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1174384658 20:50179986-50180008 GACATTCAGGAGATTGAGGCAGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175816061 20:61883775-61883797 GGGAGGAACAAGATGGAGGCAGG - Intronic
1175964034 20:62651353-62651375 GAGATTCAGATAAGGGAGGCTGG + Intronic
1176081667 20:63276520-63276542 GAGCTTGAGAAGATGAAAGCTGG + Exonic
1176287965 21:5028780-5028802 GAGAGGCAGAAGATGGAGGCAGG + Intronic
1176810374 21:13530817-13530839 GGCCTTAAGAAGAGGGAGGCAGG + Intergenic
1177883327 21:26719605-26719627 GAGATGAAGAACATGAATGCTGG - Intergenic
1178168545 21:30010777-30010799 GGGATAAAGAAGTGGGAGGCTGG - Intergenic
1178300893 21:31451975-31451997 GAGATGAAGAAGTTGGAAGAGGG + Intronic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1179170725 21:38970802-38970824 AATATTAGGAAGATGGTGGCTGG - Intergenic
1179295790 21:40061210-40061232 AAGATTAGGAAGATAGAGGCAGG - Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179869216 21:44234695-44234717 GAGAGGCAGAAGATGGAGGCAGG - Intronic
1180621910 22:17167979-17168001 GAGATGAAGAGGAGGGAGGAAGG + Intergenic
1181982847 22:26778321-26778343 GATATAATGAAGATGGAGGCTGG - Intergenic
1182202758 22:28590423-28590445 AAGATTTAGAAATTGGAGGCTGG - Intronic
1183067678 22:35374477-35374499 GATACTCAGGAGATGGAGGCAGG + Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183392314 22:37552523-37552545 GAGAGCAAGAAGTTGGAGGGGGG - Intergenic
1183752639 22:39730637-39730659 GAGATTAAGAATATAGAGGCTGG + Intergenic
1184892045 22:47386098-47386120 GAGATAAACAAGATGCATGCTGG + Intergenic
1185166004 22:49262603-49262625 GAGAGTAAGAAAAAGTAGGCTGG + Intergenic
949762486 3:7486774-7486796 GAAACTAAGAAAATGGATGCTGG + Intronic
950044898 3:9943308-9943330 GAGATGGACAAGATGGAGTCAGG + Intronic
950712534 3:14822957-14822979 GATAGTGAGAAGATGGAGCCAGG - Intronic
952272309 3:31845210-31845232 GAGCAGGAGAAGATGGAGGCAGG - Intronic
953765077 3:45733891-45733913 GTGGTTAAGAATATGGATGCAGG - Intronic
954927364 3:54248169-54248191 GAGATTAAAAGGGTGGAGCCTGG + Intronic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
956047272 3:65209021-65209043 GAAATGAAGAAAATGAAGGCTGG - Intergenic
956518496 3:70078098-70078120 AAGATTTAGAAGATGGGGGTGGG + Intergenic
956973926 3:74558248-74558270 AGGATTAAGAAGAGGGAGGAAGG - Intergenic
957157564 3:76564975-76564997 AAGATGAAAAAGAGGGAGGCTGG + Intronic
957979698 3:87492700-87492722 GAGATTAACAAATAGGAGGCTGG - Intergenic
959174626 3:102890986-102891008 GAAATAAAGAAGATGAAGGAGGG - Intergenic
960001356 3:112735214-112735236 GCGCTTAAGAATATGCAGGCCGG + Intergenic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
963075687 3:141344348-141344370 TAGAAGAAGAAGATGGAGGAAGG - Intronic
963193987 3:142506007-142506029 GAGGTTAAGAAAATGAGGGCTGG + Intronic
964279158 3:155043997-155044019 GAGATTGATAAAATGGAAGCTGG - Intronic
964380745 3:156096791-156096813 GAAATTAAGAAGATGGAGACAGG + Intronic
964459836 3:156912292-156912314 GAGACTCAGAAGGAGGAGGCTGG - Intronic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965532913 3:169792759-169792781 GAGATTCAGAAGATGGCTGAAGG - Intergenic
967225033 3:187282842-187282864 GAGATTAACATGGTGGCGGCGGG - Intronic
967342994 3:188421727-188421749 AAGCTTAAGCAGATGGAGACAGG - Intronic
967735093 3:192943361-192943383 GAGACTTAGAAAAAGGAGGCTGG + Intergenic
969257291 4:6011111-6011133 GAGAGAGAGATGATGGAGGCAGG - Intergenic
969450421 4:7269726-7269748 GAGATTAAGGTGTTGGGGGCTGG - Intronic
971104352 4:23506252-23506274 TAGATAAAGAAAATGTAGGCCGG - Intergenic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
971656540 4:29353700-29353722 GAGAGAAAGAAAATTGAGGCAGG - Intergenic
971801677 4:31300952-31300974 GAGACAAAGAAGACAGAGGCAGG - Intergenic
971926144 4:33011773-33011795 GAGATGAAGAAACTGGAGCCGGG - Intergenic
972294521 4:37723923-37723945 CAGGTTAGGAAGATGGCGGCGGG - Intergenic
973546937 4:51991536-51991558 GAGAGTAAGAAGAGAAAGGCTGG + Intergenic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
975578081 4:75882787-75882809 GCCATTAAGAGTATGGAGGCTGG - Intronic
976139279 4:81973368-81973390 TAGATTAAGAAACTGGAGGTAGG + Intronic
976397676 4:84573770-84573792 GAACTGAAGAAGATGGAGACAGG + Intergenic
977330547 4:95631993-95632015 GAGATTAAGGGAATGGAGGTGGG - Intergenic
977837372 4:101661220-101661242 GGGATTAAGAAGATGGGTTCAGG + Intronic
978456316 4:108896242-108896264 GAGATTTACAAGTTTGAGGCCGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979761638 4:124413155-124413177 GAGAGTAAGACGATGTAGACTGG + Intergenic
979800639 4:124904383-124904405 CACATCAAGAAGATGGTGGCAGG - Intergenic
980803157 4:137779324-137779346 GAGACTCAGAAGAGGGAGGCAGG - Intergenic
981015632 4:139971128-139971150 GAGATAAAGAGGTTGGAAGCTGG - Intronic
981884206 4:149653216-149653238 GAGATGGAGAAGATGGCAGCAGG + Intergenic
982303625 4:153905873-153905895 GGGATTAGGGAGATGGAGCCTGG - Intergenic
984364206 4:178777324-178777346 GAGATTTGAAAGATGGAGGCTGG + Intergenic
984746863 4:183229634-183229656 TAGATTGAGATGATGGATGCTGG - Intronic
984949283 4:184994744-184994766 GAGAGGAAGAAGACGGATGCAGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
986012110 5:3725692-3725714 AAAATGAAGAAGACGGAGGCAGG - Intergenic
986912080 5:12570374-12570396 GTGAATGTGAAGATGGAGGCAGG + Intergenic
987466528 5:18278305-18278327 GAGATAAAGAAGATTTAGGGAGG - Intergenic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
987546385 5:19315366-19315388 GAAATAAAGAAGAAGGAGCCAGG + Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
989547991 5:42696903-42696925 AAGAGTAAGAGCATGGAGGCTGG - Intronic
990386887 5:55273784-55273806 AATCTTAAGAAGATGAAGGCTGG + Intronic
990402638 5:55454619-55454641 GACATTAAGAACAGGGAAGCTGG + Intronic
991430614 5:66541061-66541083 GAGATTTAGCAGAACGAGGCTGG - Intergenic
992100315 5:73401399-73401421 GAGATGAAGAAGATGGTAGAAGG - Intergenic
992297920 5:75344897-75344919 AACATTAAGGACATGGAGGCCGG - Intronic
992734138 5:79702112-79702134 GAGATAAAGAAAATGTGGGCTGG + Intronic
995248367 5:109961191-109961213 GAGCATAAGAAGATGGAAGAGGG + Intergenic
995727943 5:115202453-115202475 GAAACTAAGAACATAGAGGCTGG + Intergenic
996186182 5:120478042-120478064 GACCTTCAGAAGCTGGAGGCAGG - Intronic
997832196 5:137159491-137159513 GAGACTCAGAAGTGGGAGGCTGG - Intronic
998547023 5:143037958-143037980 GACATTAAGATCAAGGAGGCTGG + Intronic
998617925 5:143761317-143761339 TAGATTAAGGACATGGAGGTGGG + Intergenic
999431011 5:151525450-151525472 GGGATTAAGAATTTGGAGTCTGG + Intronic
1000307565 5:160009156-160009178 GAGGCTAAGAAGGTGGAGACCGG + Exonic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1002482708 5:179513896-179513918 GAGAGTAAAAAGATGGGGCCGGG - Intergenic
1002804517 6:559964-559986 GAGATGAAGCAGGTGCAGGCAGG - Intronic
1003535844 6:6974534-6974556 GAGATTAAGAAGACGTGGCCGGG - Intergenic
1004037878 6:11941668-11941690 GACATTCAGAAGGGGGAGGCTGG - Intergenic
1004226533 6:13789814-13789836 GAGATGGAGAAGAGGGAGGGAGG + Exonic
1004935940 6:20508585-20508607 GAGATTGAGATTATAGAGGCTGG - Intergenic
1005264048 6:24092484-24092506 GAGATTCAGAACACGGAGGAGGG + Intergenic
1005498670 6:26411418-26411440 GAGCTGTAGAAGAGGGAGGCTGG + Intronic
1006109849 6:31737902-31737924 GAAATTCAGGATATGGAGGCTGG - Intronic
1006508814 6:34510402-34510424 GTGATAAAGAAGAGGCAGGCAGG - Intronic
1006721009 6:36151207-36151229 GATATTAATAAGAAGGAAGCTGG - Intergenic
1007517812 6:42427495-42427517 GTGCTTTGGAAGATGGAGGCAGG - Intronic
1007563060 6:42826529-42826551 GAGGTTAAGAACATGGAGGCTGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008722046 6:54366577-54366599 GAGATAGAGAAGAGGGAGGGAGG + Intronic
1010368789 6:75083487-75083509 GAGAGTAAGAAGATGGGAGTGGG + Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG + Intergenic
1013535508 6:111059781-111059803 GACATTAAGAAGCTGAAGGCTGG - Intergenic
1013535818 6:111062132-111062154 GACATGAAGAAGATGGTGGTTGG - Intergenic
1013799141 6:113920498-113920520 GAGGTTCAGAAGAGTGAGGCTGG - Intergenic
1013929479 6:115514024-115514046 GAAATTGAGAAGATTGAGACTGG - Intergenic
1013982438 6:116147868-116147890 GTCATTAAAAAGGTGGAGGCAGG + Intronic
1014554176 6:122825876-122825898 GAGATGTTGAAAATGGAGGCAGG - Intergenic
1015750582 6:136554457-136554479 GTAAATAAGAAAATGGAGGCTGG - Intergenic
1017220962 6:151964936-151964958 GTGATTAAGAAAATAGGGGCCGG - Intronic
1017334829 6:153243956-153243978 GAGATTCAGAAGGGGGAGGATGG - Intergenic
1018032729 6:159855322-159855344 TATATTGAGAAGATGGTGGCTGG - Intergenic
1018039813 6:159911823-159911845 GATATGAAGAAGATGGAGCTAGG - Exonic
1018706679 6:166468565-166468587 GACATAAAGAAGACAGAGGCCGG + Intronic
1019550149 7:1598128-1598150 GTCATTAAGGAGATGGAGGCTGG + Intergenic
1022028643 7:26471321-26471343 GAGTTTGAGAAGATGGATCCAGG + Intergenic
1023546115 7:41319125-41319147 GACCTTGTGAAGATGGAGGCAGG + Intergenic
1024466889 7:49720812-49720834 TGGATCAAGATGATGGAGGCAGG + Intergenic
1024565042 7:50673804-50673826 GAGATGATGCAGATGGGGGCCGG - Intronic
1025144372 7:56491942-56491964 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1025259977 7:57412421-57412443 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1025922517 7:65926950-65926972 GAGATTCAGAAGTGGGAGGTTGG + Intronic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026226639 7:68447746-68447768 GAGATTAAGCAGGTGGGGTCTGG + Intergenic
1027277710 7:76577528-76577550 GACTTTAAGAAGTTGGAAGCGGG + Intergenic
1027609710 7:80345462-80345484 GAGACTCAGAAGGTGGAGGGTGG + Intergenic
1029285673 7:99464358-99464380 GAGATTAAGAATACAGAGGCCGG + Intronic
1029847885 7:103431620-103431642 GATTTTAAGAAAATGGTGGCTGG - Intronic
1030009878 7:105155276-105155298 GAGATTAAGAATAAGGGGGCTGG - Intronic
1030170997 7:106602699-106602721 GAGATTGAGTAGATGGAGTGAGG + Intergenic
1030888493 7:114968111-114968133 AAGATTAACACGATTGAGGCTGG - Intronic
1030930141 7:115512594-115512616 GTGCTTTAGGAGATGGAGGCAGG - Intergenic
1031518960 7:122739003-122739025 AATATTAAGAAAATGGAAGCAGG + Intronic
1032122009 7:129163433-129163455 GAGACTTAGGAGATGGAGGCAGG - Intronic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032937301 7:136747750-136747772 GACAGTAAGAAAAGGGAGGCCGG + Intergenic
1034123572 7:148650899-148650921 GATCTTAAGAAAAAGGAGGCTGG + Intergenic
1034134469 7:148753339-148753361 GAGAATGAGAAGATGGGGCCAGG - Intronic
1037464713 8:19148921-19148943 GACCCTATGAAGATGGAGGCAGG + Intergenic
1037582592 8:20254450-20254472 CAGATGAAGAGGATGCAGGCCGG - Intronic
1038072322 8:24030776-24030798 GAGAAGATGAAGATGGATGCAGG + Intergenic
1038324818 8:26564924-26564946 GAGACTCAGAAGAAGGAGGGTGG - Intronic
1038464742 8:27751136-27751158 GAGATTAAGAAGAAAGCAGCTGG + Intronic
1038783134 8:30585836-30585858 GAGCTTAGGGAGATGGAGGTGGG + Intronic
1039220971 8:35330367-35330389 CAGATGAAGAAAATGGAGTCTGG - Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1040847751 8:51862007-51862029 GTGATTAAGAGCATGGAGGTCGG - Intronic
1040931721 8:52742225-52742247 GAGATTAAAAATATAGAGACTGG + Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1042197052 8:66239819-66239841 CAGATGAAGAAACTGGAGGCAGG - Intergenic
1043813104 8:84767197-84767219 GAGATGAAGCAAATGGAGACGGG - Intronic
1044352279 8:91180690-91180712 GAAAATAGGAAGATGAAGGCAGG + Intronic
1044699925 8:94956682-94956704 GTGATTCAGAGGATGGAGGGTGG + Intronic
1045816248 8:106280478-106280500 GAGATGATGAAGATGGAGACTGG - Intronic
1045951461 8:107856029-107856051 CAGATGAAGAAGCTGGAGGATGG + Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1048609594 8:136007767-136007789 GAGATGAAGCTGATGGAGCCAGG - Intergenic
1048963448 8:139598289-139598311 GAGCTTGAGCAGATGGGGGCAGG - Intergenic
1049293290 8:141815414-141815436 GAGATTGAAAACATGGTGGCCGG - Intergenic
1050037897 9:1456724-1456746 CAGATTGAGATGATGGAAGCTGG + Intergenic
1050892555 9:10842364-10842386 AAGATTAAGAAAATAGTGGCCGG - Intergenic
1051416213 9:16843628-16843650 GAGCTTAAGAATATGTAGGCTGG - Intronic
1053532038 9:38892026-38892048 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054204263 9:62116435-62116457 GAGAACAAAAAGATGGAGGAAGG + Intergenic
1054634100 9:67471929-67471951 GAGAACAAAAAGATGGAGGAAGG - Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1057408892 9:94799011-94799033 GAGAGTAAGAAAATGGATGGAGG - Intronic
1057487558 9:95497900-95497922 GAGATTGAGAGGATGGGGGGTGG - Intronic
1058415605 9:104785485-104785507 AAGATAATGAAGATGGAAGCTGG + Exonic
1059253178 9:112905462-112905484 GAGATTAGGAAGTGGGAAGCTGG + Intergenic
1059631921 9:116134238-116134260 AAGATTAAAAAGATGGAGATGGG + Intergenic
1060069836 9:120536411-120536433 GAGATGAAGAAGATGCACGAGGG - Exonic
1060356258 9:122911186-122911208 GAGATTCAGAATCTGGAGGAAGG - Exonic
1061088813 9:128414968-128414990 GAGGTGGAGAAGATGCAGGCAGG + Intronic
1061343956 9:130006935-130006957 GATATAAAGAATGTGGAGGCCGG + Intronic
1061479690 9:130891278-130891300 GAGATAAAGAACACGGGGGCGGG - Intergenic
1061500723 9:131000334-131000356 GAGATTTAGAAGATGGAAGTGGG - Intergenic
1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG + Intergenic
1062228272 9:135465990-135466012 GGGAGAAAGGAGATGGAGGCAGG + Intergenic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1185931456 X:4207868-4207890 GAGATAAAAAAGGTGGAGGAAGG + Intergenic
1186995210 X:15114281-15114303 GTGATTAAGAACATGGACCCTGG - Intergenic
1187425061 X:19170342-19170364 GAGATTGGGAAGGTGGAGGTGGG + Intergenic
1187435536 X:19265401-19265423 GAGACTCAGAAGGTGGAGGGTGG - Intergenic
1187507581 X:19889134-19889156 GAGATTAAGAATGTGAAGGCCGG + Intergenic
1187545010 X:20241981-20242003 GAGATAAAGAATATTGAGGTAGG + Intronic
1188299240 X:28487189-28487211 GTGATTAAGAATATTGAGGTGGG - Intergenic
1188397276 X:29701183-29701205 GTGGTTAAGAAGATGGGGTCTGG + Intronic
1188408631 X:29843858-29843880 GATCTTTATAAGATGGAGGCAGG - Intronic
1188922530 X:35995112-35995134 CAGATTAAAAGGATGGAAGCGGG + Intergenic
1190636518 X:52440075-52440097 GTCATTAAAAAGATGGATGCTGG - Intergenic
1190723652 X:53172102-53172124 GAGAGGAAGAAGAGGGAGGGAGG + Intergenic
1190788531 X:53677502-53677524 GCGATTAAGAACATGGACTCTGG - Intronic
1191141753 X:57121772-57121794 CAGACTAAGAAGGTGGAGGTGGG - Intergenic
1193128688 X:77896759-77896781 TATATTAAGAAAATGCAGGCCGG + Intergenic
1193210236 X:78798836-78798858 GAGATTAAGAAGATGGGTTTTGG - Intergenic
1195097164 X:101514197-101514219 GAGCATAAGATCATGGAGGCAGG + Intronic
1195118129 X:101720407-101720429 GAGATAAGGAAGGTGGAGGAGGG - Intergenic
1195307611 X:103600710-103600732 GAAAATAAAAAGATGAAGGCAGG - Intergenic
1195318473 X:103701373-103701395 GAGATTATGATGATGTAGTCTGG + Intergenic
1196397987 X:115286554-115286576 GAAATAAAGAAAAGGGAGGCCGG - Intergenic
1196465622 X:115969088-115969110 GAGACACAGAAGATGGAGGGAGG - Intergenic
1196949311 X:120860713-120860735 GAGCCTAAGAGGGTGGAGGCTGG - Intergenic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1198108291 X:133481377-133481399 GTGATTGAGAAGATGGTGGATGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1200019780 X:153192850-153192872 GAGATTAAGAAGAGTGAGTCAGG - Intergenic
1200760808 Y:7037137-7037159 GATATGGAGAGGATGGAGGCAGG + Intronic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic