ID: 955909180

View in Genome Browser
Species Human (GRCh38)
Location 3:63842764-63842786
Sequence ACTTGTGTAGTACACTACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955909180 Original CRISPR ACTTGTGTAGTACACTACCC GGG Intronic
913688195 1:121253861-121253883 TCTTGTGCAGTATACTAACCAGG + Intronic
914040049 1:144041503-144041525 TCTTGTGCAGTATACTAACCAGG + Intergenic
914149408 1:145026416-145026438 TCTTGTGCAGTATACTAACCAGG - Intronic
920475515 1:206272360-206272382 TCTTGTGCAGTATACTAACCAGG + Intronic
1071310991 10:84343455-84343477 ACTTGTTTTGTATAATACCCAGG - Intronic
1076099378 10:127763241-127763263 ACTTGTGAAGATCACAACCCAGG - Intergenic
1093088729 12:14896113-14896135 ACTTGTTTGGTGCTCTACCCGGG - Intronic
1106005263 13:25763794-25763816 ATTTGTGCAGGACACAACCCAGG - Intronic
1121823841 14:96994199-96994221 ACTTGTGTAGTACAGTACTTTGG + Intergenic
1129204940 15:74031965-74031987 ACTTGTGTAGTAGCTGACCCAGG + Intronic
1130008349 15:80125273-80125295 ACTCGTTTAGCAAACTACCCAGG + Intronic
1157596978 18:48869933-48869955 CCTTGTGTAGGACACAACCTGGG + Intergenic
1157614669 18:48979438-48979460 CCTTGTGTAGGACACAACCTGGG - Intergenic
1159119357 18:64151153-64151175 ACTTGTGAAGTTCACAGCCCAGG - Intergenic
1159586439 18:70288271-70288293 ACTTGTATACCACACTACCTTGG + Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
927681220 2:25140677-25140699 ACTTGGGTACTGCAGTACCCAGG + Intronic
929362157 2:41104745-41104767 ACTTGTCTATTATACTACTCTGG - Intergenic
930346305 2:50186506-50186528 ACTTGTGTATTACTCAGCCCTGG + Intronic
936045679 2:109186066-109186088 ACTTGTGTTGTACATTCCCAGGG + Intronic
939885585 2:147677801-147677823 GCTTGTGTAGGAAACTACTCAGG + Intergenic
943813124 2:192215273-192215295 AATTGTGTAGTTCACTACTGAGG + Intergenic
1178610519 21:34074590-34074612 ACTTGAGGAGTACATGACCCAGG - Intronic
955909180 3:63842764-63842786 ACTTGTGTAGTACACTACCCGGG + Intronic
962735771 3:138323918-138323940 ACTTGTGTAATCCCCTGCCCTGG + Intronic
964242919 3:154616881-154616903 ACATGGTTGGTACACTACCCTGG - Intergenic
965354896 3:167661834-167661856 ACATGTGTAGGGCACTACCCTGG + Intergenic
967362210 3:188644245-188644267 ACTTGTGAAGTACATTCCCAGGG - Intronic
968888852 4:3355383-3355405 ACTTTCTTAGTACACTAACCAGG - Intronic
975327332 4:73074076-73074098 GCTTGTTTAGTACAATACCATGG - Exonic
975467913 4:74731024-74731046 ACTTGTGAATTACAGTACCTCGG + Intergenic
976538653 4:86246944-86246966 ACTTAGGTTGCACACTACCCTGG - Intronic
979192517 4:117879383-117879405 ATTTGTGTAGAACAATACCAAGG - Intergenic
981931658 4:150196479-150196501 ACAAGTGAAGTACACTAACCAGG - Intronic
982232149 4:153219104-153219126 CCTTATGTAAAACACTACCCTGG - Intronic
989462128 5:41712944-41712966 ACTTGTGTAGTTCACAGTCCAGG - Intergenic
996091204 5:119353929-119353951 TCTTGTGTAGCACACGGCCCTGG + Intronic
1007899224 6:45394611-45394633 ACTTGTGAAGTTCACAGCCCAGG - Intronic
1009653953 6:66515162-66515184 ACTTATGAAGGACACTGCCCAGG + Intergenic
1018698250 6:166407326-166407348 ATTTGTGTAGTAGACAGCCCTGG + Intergenic
1024996029 7:55273761-55273783 ACTTGTGCAGGAGGCTACCCCGG + Intergenic
1026152076 7:67796393-67796415 ACGTGTGTGATACACTCCCCAGG - Intergenic
1035836885 8:2764358-2764380 ACATGAGTAATACACAACCCAGG + Intergenic
1042376930 8:68062267-68062289 ACTCCTGTAGTACACTCTCCGGG + Intronic
1045658708 8:104413453-104413475 ACTTGTGTATTAACCTTCCCAGG - Intronic
1052783338 9:32803460-32803482 ACTTGTGAAATTCACAACCCAGG + Intergenic