ID: 955909423

View in Genome Browser
Species Human (GRCh38)
Location 3:63845055-63845077
Sequence TGAGACTCCTTGAGGAACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 6, 3: 14, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955909419_955909423 5 Left 955909419 3:63845027-63845049 CCACAAAAGGACCTGGAGACAGC 0: 1
1: 0
2: 1
3: 19
4: 212
Right 955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG 0: 1
1: 1
2: 6
3: 14
4: 199
955909420_955909423 -6 Left 955909420 3:63845038-63845060 CCTGGAGACAGCTGACCTGAGAC 0: 1
1: 0
2: 0
3: 18
4: 203
Right 955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG 0: 1
1: 1
2: 6
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955909423 Original CRISPR TGAGACTCCTTGAGGAACAC AGG Exonic
900956224 1:5887891-5887913 TGGGACTCCAGGAGGAAGACAGG + Intronic
901084768 1:6603519-6603541 AGAAGCTCCTTCAGGAACACAGG - Intronic
901154664 1:7127471-7127493 TGAGACTCCTTGAGGGCCCTAGG - Intronic
903104098 1:21059931-21059953 TGTGAATCCTTGAGGGCCACAGG + Intronic
905555036 1:38875778-38875800 TGAGAGTTCTTGAGGAAGAGAGG - Exonic
906567424 1:46811084-46811106 TGAGCCTCCTCTAGGAACCCCGG + Intronic
910723210 1:90310491-90310513 CTAGACACCTTAAGGAACACAGG - Intergenic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911525687 1:98982803-98982825 TGGGGCTCCATGAGGAAGACAGG - Intronic
912590645 1:110816136-110816158 TGAGACTTCTGGAGAAACAAAGG + Intergenic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
918071126 1:181133999-181134021 TGAGCCTCTTGAAGGAACACAGG - Intergenic
918325819 1:183409816-183409838 TGAGAATACTTGAGCAACAAGGG + Intronic
918621628 1:186612116-186612138 TGAGACCCCTTGTAGAACACAGG - Intergenic
922828730 1:228539588-228539610 AGAGACACCTGGAGGAACCCAGG - Intergenic
922829421 1:228544038-228544060 AGAGACACCTTGGGGACCACAGG - Intergenic
922831063 1:228554678-228554700 TCAGACACCTTGACGACCACAGG - Intergenic
923511009 1:234653442-234653464 TGAAACTCCTAGAAGAAAACAGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1064883586 10:20084561-20084583 TGAGATTCCTTGTGGAAGGCAGG + Intronic
1071218737 10:83437493-83437515 TGAGACCCCCAGAGGAACACAGG + Intergenic
1071879110 10:89875237-89875259 TGAACCTCCTTGAAGAACCCTGG - Intergenic
1073254058 10:102139814-102139836 TGAGGCTCCTTGGGCACCACCGG - Exonic
1074884995 10:117686292-117686314 TGATGGTCCTTGGGGAACACTGG + Intergenic
1076343148 10:129763811-129763833 TGTGACTCCTTCTGGAAGACTGG + Intronic
1077246542 11:1542040-1542062 TGAGGCTCCTGGAGGACCAGAGG + Intergenic
1078044882 11:7904572-7904594 TGGGACTCCTTCAGGAATAGTGG + Intergenic
1079450729 11:20598081-20598103 TGAGACGCCTTGAGGATTTCAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084915160 11:72423288-72423310 TGTGGATCCCTGAGGAACACTGG - Intronic
1085952826 11:81353455-81353477 TGAGACTTTTTGATGAACTCTGG + Intergenic
1088479361 11:110280447-110280469 TGAGACAGCTTGAGCAACATAGG - Intronic
1089641323 11:119849111-119849133 TCAGCCTCCTTGACAAACACAGG - Intergenic
1089940725 11:122413792-122413814 TGGGGCTCCATGAGGAAGACAGG - Intergenic
1091467212 12:695402-695424 TGAGACCTCTTGAGGAACACAGG - Intergenic
1093410192 12:18856099-18856121 TGAAACTCCTAGAAGAAAACAGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1097902773 12:64889904-64889926 TGGGAGACCTTGAGGAACACAGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1100897940 12:99205565-99205587 TGGGGCTCCGTGAGGAAGACAGG - Intronic
1100930931 12:99608752-99608774 TGAGACCCCTTGAAAAACACAGG - Intronic
1100958834 12:99939546-99939568 TGAGACTTCTGGAAGAACAATGG - Intronic
1106759979 13:32858700-32858722 CAAGACTCCTTGAGGAACAATGG + Intergenic
1108301312 13:49079466-49079488 TGAGCCTCCTCGAAGAACAGTGG + Intronic
1110275350 13:73635895-73635917 TGACCTTCCTTTAGGAACACTGG + Intergenic
1112101433 13:96193916-96193938 TGGAATTCCTTGAGGAACCCAGG + Intronic
1113255208 13:108497884-108497906 TCAGTCTCCTTCAAGAACACTGG - Intergenic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114702131 14:24689701-24689723 TGAGTCTCCAGGAGGAACAATGG + Intergenic
1115068991 14:29298177-29298199 TGAGACTCATTGATTATCACAGG + Intergenic
1115290502 14:31766843-31766865 TCAGACTCCATAAGGAACAAAGG - Intronic
1116207553 14:41887512-41887534 TGAGAGTCCTGGAGGGACAAAGG + Exonic
1117307671 14:54492241-54492263 TAAGAGTCCTTTAGGAAAACTGG - Intergenic
1118045762 14:61969401-61969423 TGGGACTCTTTGAGGCATACTGG + Intergenic
1118328677 14:64799442-64799464 TGAGTCTCTTTGAAGAACCCAGG - Intronic
1118520654 14:66580756-66580778 TGAGAGAGCTTGAGAAACACTGG - Intronic
1119019919 14:71100758-71100780 AGAGAGTCTTTGAGGAATACGGG - Intronic
1119069575 14:71569121-71569143 TTATATTCCTTGAGTAACACTGG - Intronic
1119889240 14:78170357-78170379 TGAGACTGCTGGAGGAGCCCAGG - Intergenic
1121616497 14:95317214-95317236 TGAGACTTCCTGAGTACCACAGG + Intronic
1121796873 14:96742580-96742602 TGAAACTCCCTGGGGAACAGGGG - Intergenic
1122419528 14:101566717-101566739 TGAGGCCCCTTGAGGAATGCTGG + Intergenic
1124000268 15:25753514-25753536 TGAGACCCCCTGAGGAACACAGG + Intronic
1124601580 15:31136954-31136976 TGAGACCCCTGCAGGAGCACAGG + Intronic
1124910091 15:33911291-33911313 AGACACCCCTTGAGGAACAAAGG + Intronic
1125983290 15:44023660-44023682 TTAGACTACTGGAGGATCACTGG - Intronic
1128531757 15:68456393-68456415 TCAGCTTCCTTGAGGTACACTGG - Intergenic
1130134110 15:81167577-81167599 TGAGACTCCAAGAGGCAAACAGG + Intronic
1130859128 15:87870761-87870783 TGAGAATCATTGAGGCACTCAGG - Intronic
1131737254 15:95346952-95346974 TGAGAGGTCTTGAGGAACCCAGG + Intergenic
1133997447 16:10759207-10759229 TGTGGCTCCCTGAGGAACACAGG + Intronic
1136099836 16:27985885-27985907 CACGACTCCTTGAGGAACACAGG + Intronic
1137048464 16:35689127-35689149 TGAGACTCCTTGCCGACCACAGG - Intergenic
1138851267 16:60632636-60632658 TCAGACCCCTTGAGAAACACAGG - Intergenic
1144745800 17:17613477-17613499 TGGGTCCCCTTGAGGACCACAGG + Intergenic
1150654728 17:67032413-67032435 TGAGACTCCTTGATCCACCCTGG + Exonic
1155536856 18:26827755-26827777 TGAGCCTCCTTGAGGCTCAGAGG + Intergenic
1156029639 18:32697213-32697235 TGAGGCTCATTGAGCAACAGAGG + Intronic
1156358748 18:36365139-36365161 TGAAACTCCCAGAGGAAAACAGG + Intronic
1156794049 18:41019037-41019059 TGAGACTGCTGGAAGAAAACAGG + Intergenic
1159129998 18:64270555-64270577 GGAGAGACCTTCAGGAACACAGG + Intergenic
1164154002 19:22577917-22577939 TGAAAACCCTTGAGGAACAAAGG - Intergenic
1164380713 19:27735039-27735061 AGAGACTCCTTCATGACCACAGG - Intergenic
1164380828 19:27735808-27735830 AGAGACACCTTGACGAGCACAGG - Intergenic
1164383948 19:27757843-27757865 AGAGACACCTTGACGACCACAGG - Intergenic
1164385619 19:27768669-27768691 AGAGACTCCTTGCTGACCACAGG - Intergenic
1164528556 19:29029658-29029680 AGAGGCTCTTTGAGCAACACTGG + Intergenic
1165356868 19:35309879-35309901 TGGGACTCCAGGAGGAGCACAGG - Exonic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167352015 19:48981449-48981471 TGAGACTCTAGGAGAAACACAGG + Intronic
1167718758 19:51162816-51162838 TAAAACTCCTTGAAGAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168198737 19:54797270-54797292 TGAGACTGAAAGAGGAACACAGG + Intronic
926329225 2:11811003-11811025 TGAGAATGCTAGAGGAACAGGGG + Intronic
927971470 2:27308225-27308247 GAAGACGCCTTGGGGAACACAGG + Exonic
929117681 2:38457871-38457893 GGAGAGCCCTTGAGGATCACCGG - Intergenic
929371817 2:41234422-41234444 TCACACTCAATGAGGAACACAGG + Intergenic
929893492 2:45938078-45938100 TGAGAATCCAAGAGGAACAGAGG - Intronic
933671124 2:85008115-85008137 TGAGATTCCTCTAGGAACAGAGG - Intronic
934690140 2:96352312-96352334 TGACACTCCAGGAGGAACCCAGG - Intronic
935160934 2:100528829-100528851 TGACACTCCTGGAAGGACACTGG + Intergenic
936061205 2:109296828-109296850 TGAGACGCCTTGGGGGCCACTGG - Intronic
937438987 2:121901235-121901257 TGTCACTCCTTGAGGAAAAGCGG + Intergenic
937994554 2:127683106-127683128 TGAGATTCTTTGAGCAAAACAGG - Intergenic
938106795 2:128537115-128537137 TGGGCCCTCTTGAGGAACACAGG + Intergenic
940321129 2:152377800-152377822 TAAGACTACTTGAGAAACAAGGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941741612 2:169041188-169041210 TGAGACTCTTTGGGGAATAAGGG + Intergenic
942620312 2:177838133-177838155 TGAGGTTCCATGAGGAAAACAGG - Intronic
943496902 2:188631453-188631475 TGAACTTCCTTTAGGAACACTGG + Intergenic
946156913 2:217813138-217813160 TCAGACCCCTGGAGGAACCCAGG + Intronic
946331764 2:219013535-219013557 TGGGACACCTTGAAGAGCACTGG + Exonic
1169502120 20:6170657-6170679 TGAGAATCTTTGTGGAACCCTGG + Intergenic
1170487840 20:16837827-16837849 TGACTCTTCTTGAGAAACACAGG + Intergenic
1173557455 20:43976330-43976352 TGAGAGACCATGTGGAACACAGG - Intronic
1174708335 20:52679458-52679480 TGAGTCTCCCTCAGGAACAGGGG + Intergenic
1177744665 21:25197279-25197301 TGAGACTTCTTTACGAACAACGG - Intergenic
1178113225 21:29391166-29391188 TGTGACTCCTTGAAGAAGCCAGG + Intronic
1178626467 21:34222856-34222878 TGAGACTCCCTGAGAAACACTGG - Intergenic
1179635316 21:42704820-42704842 TGAGAATCAGTGAGGAACCCAGG - Intronic
1180490478 22:15841708-15841730 TGAGCCTCCCTGAGGTTCACTGG + Intergenic
1182357496 22:29728904-29728926 AGAGAGTCCTTGACCAACACCGG - Intronic
1184186646 22:42869296-42869318 TGAGACTCCTCAAGAAACCCTGG + Intronic
949990323 3:9573607-9573629 TGGGGCTCCGTGAGGAAGACAGG - Intergenic
953176649 3:40559532-40559554 TGGGATTCCATGAGGAAGACAGG + Intronic
953512881 3:43560812-43560834 AGAGACTCATTGATGAACAATGG - Intronic
953808296 3:46090577-46090599 AGAAGCTCCGTGAGGAACACGGG + Intergenic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
956978100 3:74605690-74605712 CAAGCCTCCTTGAGAAACACAGG - Intergenic
957430133 3:80094066-80094088 TGAGACCCCTCCAGGAAAACAGG + Intergenic
958440089 3:94145959-94145981 TAAGCCTCCTTGAGAAACAGTGG + Intergenic
958451951 3:94284126-94284148 TGACACTCCTTCATGAACATGGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963914997 3:150851065-150851087 TGAGACCCCTTGTGGAATGCAGG - Intergenic
965011673 3:163101133-163101155 TGAGGATACTTGGGGAACACTGG + Intergenic
966846899 3:184137784-184137806 CCAGAGCCCTTGAGGAACACAGG + Exonic
974861811 4:67531726-67531748 TATGGCCCCTTGAGGAACACAGG + Intronic
979502317 4:121454671-121454693 GGAGACTGCATGAGGAACTCAGG - Intergenic
981105759 4:140878853-140878875 TAAAACTCCTAGAGGAAAACAGG - Intronic
981770348 4:148300982-148301004 TGGGGCTCCATGAGGAAAACAGG - Intronic
984497462 4:180516372-180516394 TGAGGCTGCTTGAGTAATACAGG + Intergenic
985582988 5:709558-709580 TCTGACTCCATGAGGCACACTGG - Intergenic
985596666 5:794809-794831 TCTGACTCCATGAGGCACACTGG - Intergenic
986475783 5:8130777-8130799 TGAGACTTCATTAGGAAGACTGG - Intergenic
988286589 5:29226285-29226307 TGAGACTGCCTGGGCAACACAGG - Intergenic
992722491 5:79574556-79574578 TGAGACTCCATGAGAGACAGAGG + Intergenic
993512830 5:88793438-88793460 TGAGAGTCCTTGAGGGACCTTGG + Intronic
996856597 5:128015072-128015094 AGAAACTCCTTCAGGAACACAGG + Intergenic
997013892 5:129907287-129907309 TGAAACTCATTGAGATACACGGG + Intronic
997748718 5:136323437-136323459 TAAGACTTCTAGAGGAAAACAGG - Intronic
1001854487 5:174999208-174999230 TGAGGGTCTTTGAGGATCACAGG - Intergenic
1007191108 6:40019613-40019635 TGAAACTACTAGAGGAAAACGGG + Intergenic
1007391951 6:41554519-41554541 AGATTCTCCTTGAGGAATACTGG - Intronic
1009375956 6:62969252-62969274 TGAGGTTCATTGAGCAACACTGG + Intergenic
1009401588 6:63262639-63262661 TGACCTTCCTTTAGGAACACTGG - Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011593826 6:88997145-88997167 TGAGACCCCCTGAGGAACACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017654174 6:156611498-156611520 TGAGACCCCCTGATGAAGACAGG + Intergenic
1019022390 6:168930307-168930329 TGGGTCTCCTTGAGGTTCACTGG + Intergenic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1020020080 7:4860936-4860958 TCAGGCTCCTTCAGTAACACTGG + Exonic
1020577808 7:9956511-9956533 AGAAACGCCTTGATGAACACTGG - Intergenic
1020764169 7:12300378-12300400 TGAGACTTATTGAGGAACACAGG + Intergenic
1021840971 7:24721651-24721673 TGAGCCTCATAGAGGGACACGGG - Intronic
1023137467 7:37066531-37066553 TGAGGCTCTTTGAGGCACAGAGG - Intronic
1023833942 7:44057616-44057638 TGTGTCTCCTTGAGGGTCACTGG + Intronic
1026251872 7:68678359-68678381 TGAGACTCCCTGAGAAACTCAGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030956943 7:115864628-115864650 TTAGAATCCTTGGGGAAGACTGG - Intergenic
1032951508 7:136919950-136919972 TGAGAAACATTGAGGAATACAGG - Intronic
1033446514 7:141427594-141427616 TGAAACTACTGGAGGAAAACAGG + Intronic
1035194346 7:157203803-157203825 AGATACTCCTTGAGGTACAATGG + Intronic
1035735290 8:1882973-1882995 TGAGAATCATTGAGAATCACTGG + Intronic
1042015863 8:64310330-64310352 TGAAAATCCTTGAAGAAAACAGG + Intergenic
1042510660 8:69607949-69607971 TGACACTCCATGGGGAACAAAGG + Intronic
1042994263 8:74677895-74677917 TGAGACTGATTGAGGAAAAAAGG + Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1048982878 8:139712513-139712535 TCAGACTCCCTGGGGAACTCAGG - Intergenic
1050228543 9:3491208-3491230 TGAGATTACTTGAAGAAGACAGG + Intronic
1052638086 9:31128585-31128607 TGAGACTTCCTGAGCACCACTGG - Intergenic
1055053458 9:72002093-72002115 TGAGACTGGTGGAGGAACAGGGG + Intergenic
1056507106 9:87267971-87267993 AGAGGCTCCCTGAGGAACGCAGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057913904 9:99041061-99041083 TGGGACTCCCTCAGGAACACAGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060883721 9:127136173-127136195 AGAGACTCCTTGGGTAACCCTGG - Intronic
1189157814 X:38777326-38777348 TAAAACTCCTTGAAGAAGACAGG + Intergenic
1189618238 X:42807744-42807766 TAAGTCTCCATGAGGAAGACAGG + Intergenic
1191232215 X:58104967-58104989 TGAGACTCCTTGCTGACCATAGG + Intergenic
1191236711 X:58139996-58140018 AGAGACTCCTTGTTGACCACAGG + Intergenic
1191242364 X:58199486-58199508 AGAGACTCCTTGTGGACCAAAGG + Intergenic
1191244596 X:58216058-58216080 AGAGACTCCTTGTCGAACCCAGG + Intergenic
1191247465 X:58239165-58239187 AGAGACTCCTGGACGAACTCAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191643870 X:63457563-63457585 TGACACTTCTTGTGGCACACAGG - Intergenic
1193139344 X:78009971-78009993 TAAGACTTATTGAAGAACACAGG - Intronic
1195842220 X:109186630-109186652 TGAGACCCCTTGAGGAACACAGG - Intergenic
1198020684 X:132654835-132654857 TGTGGCTCCTTGAGGAAGAGTGG - Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1200684552 Y:6246841-6246863 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200706934 Y:6451094-6451116 AGAGCAACCTTGAGGAACACAGG + Intergenic
1200990081 Y:9338100-9338122 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200992743 Y:9358415-9358437 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200995396 Y:9378693-9378715 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200998061 Y:9399039-9399061 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201000571 Y:9467573-9467595 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201003237 Y:9487903-9487925 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201005894 Y:9508185-9508207 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201008551 Y:9528498-9528520 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201011133 Y:9548667-9548689 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201027178 Y:9713614-9713636 AGAGCAACCTTGAGGAACACAGG - Intergenic
1201360636 Y:13144257-13144279 TGAGACTTCTTCAAGAACAAGGG + Intergenic
1202368703 Y:24183262-24183284 AGAGTGTCCCTGAGGAACACAGG - Intergenic
1202502082 Y:25486855-25486877 AGAGTGTCCCTGAGGAACACAGG + Intergenic