ID: 955909434

View in Genome Browser
Species Human (GRCh38)
Location 3:63845093-63845115
Sequence CCCCCCACCCCCAGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 1, 2: 14, 3: 75, 4: 690}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955909434_955909436 4 Left 955909434 3:63845093-63845115 CCTTCTTTTCTGGGGGTGGGGGG 0: 1
1: 1
2: 14
3: 75
4: 690
Right 955909436 3:63845120-63845142 ATCTCCTTCATGTAGCCCTGAGG 0: 1
1: 0
2: 3
3: 13
4: 136
955909434_955909437 5 Left 955909434 3:63845093-63845115 CCTTCTTTTCTGGGGGTGGGGGG 0: 1
1: 1
2: 14
3: 75
4: 690
Right 955909437 3:63845121-63845143 TCTCCTTCATGTAGCCCTGAGGG 0: 1
1: 0
2: 2
3: 16
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955909434 Original CRISPR CCCCCCACCCCCAGAAAAGA AGG (reversed) Intronic