ID: 955909437

View in Genome Browser
Species Human (GRCh38)
Location 3:63845121-63845143
Sequence TCTCCTTCATGTAGCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955909434_955909437 5 Left 955909434 3:63845093-63845115 CCTTCTTTTCTGGGGGTGGGGGG 0: 1
1: 1
2: 14
3: 75
4: 690
Right 955909437 3:63845121-63845143 TCTCCTTCATGTAGCCCTGAGGG 0: 1
1: 0
2: 2
3: 16
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955909437 Original CRISPR TCTCCTTCATGTAGCCCTGA GGG Intronic
900515370 1:3079354-3079376 GCTCCTTCATGCTGCCCTGCTGG + Intronic
900995564 1:6121538-6121560 TCTCATCCATGTAGCCCAGCTGG + Exonic
902285850 1:15408380-15408402 TCTCCTGTATGCAGCCCTGAAGG - Intergenic
903564235 1:24252787-24252809 TCTCCTACATACACCCCTGAGGG - Intergenic
904411038 1:30325092-30325114 ACTCCTTCTTGAAGCCCTGGTGG + Intergenic
907576304 1:55528817-55528839 TCTTCCTGACGTAGCCCTGAGGG - Intergenic
910458182 1:87420807-87420829 ACACCTTCATCTAGCCCTGAAGG - Intergenic
910505213 1:87942808-87942830 TTATCTTCATGTAGCCCTAAGGG + Intergenic
914315481 1:146507591-146507613 ACACCTTCATCTAGCCCTGAAGG - Intergenic
914498874 1:148225770-148225792 ACACCTTCATCTAGCCCTGAAGG + Intergenic
916378766 1:164185696-164185718 TCTCCTTCAACTTGCCTTGAAGG + Intergenic
917609113 1:176668238-176668260 TCACCTATATGTATCCCTGAAGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
920196534 1:204230965-204230987 GCTCCTTCTGGAAGCCCTGAGGG - Intronic
1067666565 10:48284463-48284485 TCCCCTGCATGTAGCCAGGAGGG + Intergenic
1067849357 10:49745009-49745031 CCACCTTCATGGAGCTCTGAGGG - Intronic
1074141772 10:110679787-110679809 CCGCCTTCCTCTAGCCCTGATGG + Intronic
1077584102 11:3437328-3437350 CCTCCTTCTTGTAGACCTGGAGG + Intergenic
1079057278 11:17217067-17217089 TCTCCTTCTTGTCGCCCAGCTGG - Intronic
1079938699 11:26650432-26650454 TCGACTTCATGGACCCCTGAAGG - Intronic
1082278811 11:50247677-50247699 CCTCCTTCCCGTAGCCCGGATGG + Intergenic
1082887683 11:58104848-58104870 TCTGCTTCATGTAGCCATTCAGG - Intronic
1083161351 11:60856112-60856134 TCTCCTTCATGAAGCGGGGATGG - Intergenic
1085045819 11:73352823-73352845 GCGGCTGCATGTAGCCCTGAAGG - Exonic
1085067253 11:73508511-73508533 TCTCCTACTTCTAGCCCTGCAGG + Intronic
1089135988 11:116249734-116249756 TCTCTTTCTAGTAGCACTGATGG - Intergenic
1091139950 11:133226457-133226479 CCTCTTTCTTGTATCCCTGAAGG + Intronic
1091917505 12:4280498-4280520 TATCCTTCCTGCAGCCCTGGGGG + Intronic
1092507082 12:9113461-9113483 TCTCATTCAGGTAGCTCAGAAGG + Exonic
1096616885 12:52838308-52838330 TCTCCTTCAGGAAGCTCTGCAGG - Intronic
1096910912 12:54983061-54983083 TCCCCTTACTGTAGCCCAGAAGG + Intronic
1098873856 12:75846449-75846471 ACTCCTTCATGAAGCTCTAAGGG + Intergenic
1101303455 12:103504324-103504346 TCTCCGACAGGAAGCCCTGAAGG - Intergenic
1103143999 12:118578210-118578232 TCTCCTTTACTTAGCCCTGAAGG + Intergenic
1103886477 12:124205938-124205960 TCTTCTTCATGTCCCCTTGAAGG + Intronic
1111924254 13:94445965-94445987 TCTCCTTCCTGGAACCCAGAGGG - Intronic
1112694707 13:101935239-101935261 GCTGCTGGATGTAGCCCTGAAGG - Intronic
1116572771 14:46538768-46538790 TCTCTTTCATGTAGTCTTTAGGG + Intergenic
1116651762 14:47602972-47602994 TCTACTTAATGTAGGACTGATGG - Intronic
1117538996 14:56728608-56728630 ACTCCTTCCTATAGCTCTGAAGG + Intronic
1117632145 14:57704887-57704909 TCTGCTGCAAGAAGCCCTGATGG - Intronic
1121634709 14:95446079-95446101 TCTCCCACAGGCAGCCCTGATGG - Exonic
1122584274 14:102793913-102793935 TCTGCTCCATGTGGCCTTGATGG + Intronic
1122797471 14:104213141-104213163 TCTCCATCATGAACTCCTGAAGG + Intergenic
1127147941 15:56044077-56044099 TTTTCTTCATGTAGCCCCAAAGG - Intergenic
1128993030 15:72276302-72276324 TCTCCTTCAAGTGGCCATGGAGG - Intronic
1133738694 16:8635094-8635116 TCCGCTTCCTGTGGCCCTGATGG + Intronic
1135403378 16:22181512-22181534 TCTTCTTGATGTGGCCCTGGTGG - Exonic
1135797992 16:25464005-25464027 GCTCCTTCATGGAGCCTTCAAGG + Intergenic
1137637452 16:49999274-49999296 TTTCCTTCTGGAAGCCCTGAGGG - Intergenic
1139503385 16:67386709-67386731 TCTCTCTGATGTGGCCCTGAAGG - Intergenic
1144037616 17:11381681-11381703 TCACCTTCATGTGGCTCTGATGG - Intronic
1146950018 17:36899558-36899580 TCTCCATCCTGTATCTCTGAGGG + Intergenic
1147014642 17:37481701-37481723 TTTCATAGATGTAGCCCTGAAGG + Intergenic
1147377580 17:40032135-40032157 TCTCTTTCATCTACCCCTGAAGG + Intronic
1147987627 17:44315445-44315467 GCTCCTCCAGGTAGCCCTGCGGG - Exonic
1149627842 17:58092408-58092430 TCTCCTCCAGGAAGCCCTGCAGG - Exonic
1155849823 18:30759643-30759665 TCTACTTCCTCTAGCACTGATGG - Intergenic
1156556662 18:38076116-38076138 TCCCCAGCATGTAGACCTGAAGG - Intergenic
1163130296 19:15268351-15268373 GATCCTACATGTAGACCTGAAGG - Intronic
1163416961 19:17192739-17192761 TCTCCTTCAGGAAGACCTGGTGG - Exonic
925968338 2:9087351-9087373 TCTCCCTCTTGGGGCCCTGATGG + Intergenic
929245744 2:39701179-39701201 TATCCTTCATTTCACCCTGAAGG + Intronic
930723115 2:54656957-54656979 TCTTCTTCATGTAGTCATGTTGG + Intronic
930746238 2:54885978-54886000 TCACATTCATGTAGCCATAATGG + Intronic
932793168 2:74673435-74673457 TCTCCTCCCTGTCGCCCTGCAGG + Exonic
934104792 2:88685781-88685803 TCTCCATCATGTATCCCTGATGG - Intergenic
934551072 2:95261922-95261944 ACACCTCCATGTAGCTCTGAAGG - Intergenic
937135973 2:119553543-119553565 TCTCATTCATGTCTCCCTAAGGG - Intronic
942037717 2:172026994-172027016 ACCCCTTTATGTTGCCCTGAAGG - Intronic
944956530 2:204817955-204817977 TCTCCTTCCTCTAGGCCAGAAGG + Intronic
945852295 2:215023445-215023467 TTTCCATAATGTAACCCTGAAGG + Intronic
946246822 2:218392639-218392661 TTTCCTTCATGTAGCCCAGAGGG + Intronic
948250759 2:236526849-236526871 TCTACTGCAAGTTGCCCTGAAGG - Intergenic
948260429 2:236600439-236600461 CCTCCTTCAGGTAGCCCTCGGGG - Intergenic
948602750 2:239116597-239116619 TCTTCTTCATGTAGCAGTGAGGG + Intronic
948924632 2:241087503-241087525 TGTCCTGCATGTAGCCCACAGGG + Exonic
948974987 2:241458461-241458483 CCTCCTTCCTGGTGCCCTGAGGG + Intronic
1177067232 21:16455081-16455103 TCTCATTCATAAAGTCCTGAAGG - Intergenic
1180715881 22:17872008-17872030 CCTTCTTCATGGAGCCCTGCAGG + Exonic
1182848693 22:33452702-33452724 TCTCCTTTATGTACCCCAGATGG - Intronic
1183027664 22:35077958-35077980 TCTCCTCCATTTACCCCAGAAGG - Intronic
1183451435 22:37898031-37898053 CCTCCTACATGTAGCCCTCTGGG + Intergenic
955909437 3:63845121-63845143 TCTCCTTCATGTAGCCCTGAGGG + Intronic
957427527 3:80058913-80058935 CTTCCTTCATATAGCCATGAGGG - Intergenic
957783704 3:84851824-84851846 TCTCTTTCATATAGCTGTGAAGG - Intergenic
958965613 3:100554735-100554757 TTTCCTTCAGATAGGCCTGAAGG + Intronic
960835465 3:121902100-121902122 TTTCCTGTATGTAGCTCTGAAGG - Intronic
960949603 3:122990671-122990693 TCTCCTTCATGGAGCCCTCCTGG + Intronic
963759679 3:149274499-149274521 TCTTCTTCATGCTTCCCTGACGG + Intergenic
964839463 3:160978252-160978274 TCTGGTTTATGTAGGCCTGAAGG + Intronic
964949747 3:162275878-162275900 ACTCCTTTCTGTAGCCCTCAAGG - Intergenic
965733112 3:171792975-171792997 TCTCCTTCAGGTATTCCTGGTGG - Intronic
968971699 4:3799097-3799119 CCTCCTTCAGGAAGCCCTCAGGG + Intergenic
969509844 4:7611553-7611575 TCACCTTCAGGGGGCCCTGAAGG - Intronic
971532207 4:27703345-27703367 CCTCCTTCCTGTAGCCATCATGG - Intergenic
972830295 4:42807058-42807080 TATACTTCATTTAGACCTGATGG + Intergenic
975735495 4:77377136-77377158 TATCCTACATGGAGCCATGATGG + Intronic
984736361 4:183112196-183112218 AGTCCTTCATTTACCCCTGAAGG + Intronic
989279102 5:39621330-39621352 TCTCCTTCTTGTAGCCTTCAAGG + Intergenic
992989961 5:82274235-82274257 TTTCCTTCATGTATCCATGGAGG - Exonic
993245845 5:85452137-85452159 TCTTCCTCATGAAGCCGTGAGGG + Intergenic
993326149 5:86539359-86539381 TATCCTATATGTAGCACTGAAGG - Intergenic
995229312 5:109740538-109740560 TCTCCTTAATGAAGCCATGCTGG - Intronic
995652666 5:114387742-114387764 TCTACATCCTGTAGCTCTGAGGG + Intronic
999903159 5:156109469-156109491 ACTCCTTAATGTAGCCTGGATGG + Intronic
1002342455 5:178526090-178526112 TCTCCTTCAGGAAGCCCTCTTGG - Intronic
1005384725 6:25274693-25274715 GCTGCTTCATGCAGCCCTCATGG - Intergenic
1007307181 6:40916142-40916164 TCTCCACCATGTCACCCTGAAGG - Intergenic
1008113883 6:47524454-47524476 ACCCCTTCATCTAGGCCTGAAGG + Intronic
1013073995 6:106754487-106754509 TCTGCTTCCTCCAGCCCTGAGGG - Intergenic
1013276065 6:108585914-108585936 TCTCTTCCATGTACCCTTGAAGG - Intronic
1016432850 6:144006685-144006707 TCTCCTTCAGGTAGGCATGAAGG + Intronic
1017792476 6:157813489-157813511 TCTTCCTCATGGAGCCCTGAGGG - Intronic
1017798053 6:157865435-157865457 TGTTCTTCATGACGCCCTGAGGG + Intronic
1018937582 6:168283785-168283807 TCTCCTTCATGCAGGCTTGCAGG - Intergenic
1018990731 6:168671556-168671578 TCTCCGTCATGCATCCCTGGGGG + Intronic
1024177023 7:46851014-46851036 ACTCCTGCTTGGAGCCCTGAAGG - Intergenic
1026223299 7:68419015-68419037 TCTCCTGTATGTATCCCTTAGGG - Intergenic
1030173262 7:106626106-106626128 TCTCCTACATGTATTCCTCACGG - Intergenic
1034302021 7:150024508-150024530 TTTCCTTCATGTTGCTCTGATGG + Intergenic
1034804031 7:154072807-154072829 TTTCCTTCATGTTGCTCTGATGG - Intronic
1040106023 8:43542469-43542491 TCACATTCTTGTACCCCTGAGGG + Intergenic
1042518728 8:69687278-69687300 TCTCCTTCGTGTAGTCAGGAGGG - Intronic
1048860899 8:138723971-138723993 TCTCCCTCATTGAGCCCAGATGG - Intronic
1049743980 8:144255322-144255344 TCTCCTGCCTCTACCCCTGAGGG + Intronic
1052062057 9:23972595-23972617 TCTCCTTAGTCTAGCCCTGTGGG + Intergenic
1053094016 9:35308252-35308274 TCTTCCTCATGTTTCCCTGAAGG - Intronic
1054762209 9:69013543-69013565 TCACCTGCAGGTAGCCCTGCTGG + Exonic
1055772351 9:79730842-79730864 CTTCCTTCATGGAGCCCTCATGG - Intergenic
1055935649 9:81602073-81602095 CCTCCTTCATGAAGCCTTCATGG - Intronic
1056024348 9:82477354-82477376 CCTCCTTCATGTCACCCTGTGGG + Intergenic
1056551671 9:87658135-87658157 CCTCCTTCACGAAGCCCTGTGGG - Intronic
1056949263 9:91029027-91029049 TTTCCTTCCTGTGGTCCTGAGGG + Intergenic
1058201788 9:102052091-102052113 TCATCTTCATGGAGCTCTGATGG - Intergenic
1058819560 9:108717013-108717035 TCTCCTCCGTGTACCTCTGATGG - Intergenic
1060112045 9:120913480-120913502 TCTCCTTCATGAAGTGCTGCAGG + Exonic
1062633724 9:137478886-137478908 TCTCCTTCATCTTGCCCTTTGGG - Intronic
1186674313 X:11799864-11799886 TCTTCTCCATGTAGTCCTCATGG - Intergenic
1188416803 X:29945132-29945154 TCTCCTCTCTGTGGCCCTGAGGG + Intronic
1194687811 X:96946109-96946131 GCTACTTCATGTAGGCCTGGTGG + Intronic
1195468903 X:105211374-105211396 TCCTCTGTATGTAGCCCTGAAGG + Intronic
1196276616 X:113773417-113773439 ATTACTTCATGGAGCCCTGACGG + Intergenic
1197313876 X:124939844-124939866 TCTACTTTATTTAGCCTTGATGG - Intronic
1197862715 X:130987415-130987437 TGTCATTCCTGTAGCCCTGAGGG - Intergenic
1197940016 X:131779350-131779372 TCTCCAACAGGTAGCCCTCAGGG + Intergenic
1201552452 Y:15232509-15232531 TTTCCTTCATGTAGAACTCATGG - Intergenic