ID: 955909709

View in Genome Browser
Species Human (GRCh38)
Location 3:63847439-63847461
Sequence CAGAAGAATGAAAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1570
Summary {0: 1, 1: 0, 2: 8, 3: 131, 4: 1430}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955909706_955909709 8 Left 955909706 3:63847408-63847430 CCTAAAGTGCTGTGTCTCCAAAA 0: 1
1: 0
2: 5
3: 41
4: 483
Right 955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG 0: 1
1: 0
2: 8
3: 131
4: 1430
955909707_955909709 -9 Left 955909707 3:63847425-63847447 CCAAAAAGCTATATCAGAAGAAT 0: 1
1: 0
2: 0
3: 36
4: 393
Right 955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG 0: 1
1: 0
2: 8
3: 131
4: 1430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955909709 Original CRISPR CAGAAGAATGAAAAGAAGGC CGG Intronic
900012593 1:129982-130004 TAAAAGAGAGAAAAGAAGGCTGG + Intergenic
900042657 1:485969-485991 TAAAAGAGAGAAAAGAAGGCTGG + Intergenic
900064095 1:720960-720982 TAAAAGAGAGAAAAGAAGGCTGG + Intergenic
901087246 1:6618629-6618651 AAAAAGAAAGAAAAGAAAGCAGG - Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901711130 1:11116110-11116132 CACAAGAATGTAAAAAAGACTGG - Intronic
901851247 1:12017387-12017409 AAAAAGAATGAAAAGAAGATAGG - Intergenic
902665643 1:17935784-17935806 AAGAAGAAAGGAAAGAAGGGAGG - Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903196850 1:21696447-21696469 AAGAAGAAGGGAAAGAAAGCGGG + Intronic
903275240 1:22217464-22217486 CAGAAAAATAAATAGAATGCAGG - Intergenic
903467447 1:23561753-23561775 TAGAGGAAGGAAAAGAAGGGAGG - Intergenic
903505049 1:23827759-23827781 TAGCAAGATGAAAAGAAGGCTGG + Intronic
903649109 1:24912299-24912321 CCCCAGAAAGAAAAGAAGGCAGG + Intronic
903656631 1:24953068-24953090 TTGAAAAATGAAAAAAAGGCAGG + Intronic
903796042 1:25929648-25929670 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
903926102 1:26831809-26831831 CTGAAGAATGAGTAGAGGGCTGG - Intronic
904262064 1:29293565-29293587 CAGAAGAATGGCATGAATGCGGG - Intronic
904308196 1:29604199-29604221 CAGAAGAAAGCAAAAAAGGAAGG - Intergenic
904514540 1:31044103-31044125 TACAAAAATAAAAAGAAGGCCGG + Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904720931 1:32508058-32508080 CAGAAGAAAGAACAGTAGGCTGG - Intronic
904748614 1:32726642-32726664 CAAAAGAAAAAAAAAAAGGCCGG - Intergenic
904876163 1:33656138-33656160 GGGAAGGATGAAAAGAAGGAAGG + Intronic
904896963 1:33824743-33824765 CAGAAGGATGAGAAGAACGATGG + Intronic
905049682 1:35039329-35039351 GAGAAGAAAGAAAAGAAAGAAGG + Intergenic
905080163 1:35312046-35312068 CAAAAGAAAGAAAAACAGGCAGG - Intronic
905185859 1:36196484-36196506 CAAGAGAATGAAAAGACAGCCGG - Intergenic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905570491 1:39000643-39000665 AAGAAAAAAGAAAAAAAGGCCGG - Intronic
905638212 1:39570155-39570177 CAGCAGAAAGAGAAAAAGGCAGG + Intronic
905806158 1:40879102-40879124 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
905994348 1:42368099-42368121 CAGAAGTATGAAATGAAGCCTGG + Intergenic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906439377 1:45827579-45827601 CAGAATGAAGGAAAGAAGGCAGG + Intronic
906462337 1:46044480-46044502 AAGAATAATAAAAAGAAGGAAGG - Intronic
906587871 1:46995757-46995779 GAGGAGAATGAAAAGAACTCTGG - Intergenic
906630891 1:47367020-47367042 TAAAAGAAAGAAAAAAAGGCTGG - Intronic
906644909 1:47467660-47467682 CTGAAGAATAAAAAGAAGGTTGG - Intergenic
906945752 1:50292890-50292912 TAGAAATATGAAAATAAGGCCGG + Intergenic
907066703 1:51491551-51491573 CAGAAGAATGAAAAATAGTAAGG + Intronic
907087752 1:51692648-51692670 AAGAAGAAAGAAAGGAAGGGAGG - Intronic
907110706 1:51923901-51923923 CTGAAGAATGAGAAGAAGTTAGG - Intronic
907131515 1:52101603-52101625 AAGAATAACTAAAAGAAGGCTGG + Intergenic
907483331 1:54759707-54759729 AACAAAAAAGAAAAGAAGGCTGG + Intronic
907643542 1:56217219-56217241 TGGAAGAAAGAAAAGAAGGAAGG + Intergenic
907773214 1:57486872-57486894 GTGAAGAAAGAAAAGAAGACAGG + Intronic
907824219 1:57999913-57999935 GAAAAGAAGGAAAAGAAGGAAGG + Intronic
907885258 1:58586944-58586966 GAGACGGATGAATAGAAGGCTGG - Intergenic
908151376 1:61306144-61306166 GAAAACAATCAAAAGAAGGCTGG - Intronic
908333709 1:63098106-63098128 AAAAAGAAAGAAAAGAAGGAAGG + Intergenic
908613324 1:65887380-65887402 AAAAAGAAAGAAAAGAAGGAAGG - Intronic
909712536 1:78668289-78668311 AAAAAGAAAGAAAAGAAGGAAGG + Intergenic
909913224 1:81285913-81285935 AAAAAGAAGGAAAAGAAGCCTGG - Intergenic
909942831 1:81631195-81631217 AAGAAAAAAGAAAAGAAGGTCGG - Intronic
909989298 1:82202744-82202766 CAGAGTAATGGAAAGAAGGGAGG + Intergenic
910209705 1:84780355-84780377 CAGAAGAAAGAACAGCAGGTTGG + Intergenic
910226506 1:84941402-84941424 CAGAAGAATGGCATGAAGCCGGG + Intronic
910928135 1:92417127-92417149 GAGAAGAAGGAAAATAAGTCTGG + Intergenic
910966208 1:92810579-92810601 CATAAGAATGAAAAGCAGGTAGG + Intergenic
910974587 1:92892914-92892936 CAAATGAATGAAATGAAGCCAGG + Intronic
911165067 1:94717550-94717572 TAAAAGAATGAAAGGAAGGATGG + Intergenic
911335769 1:96578307-96578329 AAGAAGAAAGAAAAGAAGGAAGG + Intergenic
911427798 1:97742268-97742290 CAAAAGAATGACAAGGAGACTGG - Intronic
911504696 1:98734061-98734083 CAGAAGAATGGACAAGAGGCTGG - Intronic
911605487 1:99899918-99899940 AAGAAGAAAGAAAAGAAAGAAGG - Intronic
911674709 1:100646638-100646660 GAGAAGAAAGAAAAGCAGGGTGG + Intergenic
912651229 1:111441391-111441413 TAGAAGAAAGAAAAAAAGTCGGG + Intronic
912912420 1:113775323-113775345 AAGAAGAGTAGAAAGAAGGCAGG - Intronic
912973166 1:114303194-114303216 CAAAAGAAAGAAAATCAGGCTGG - Intergenic
913072105 1:115308728-115308750 AAGAAGAAAGGAAAGAAGGGAGG + Intronic
913162317 1:116155395-116155417 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
913163876 1:116168123-116168145 GAGAAGAAGGAAGAGAAGGTGGG + Intergenic
913255322 1:116947921-116947943 CAGAAGACAGAAAATAAGGTGGG - Intronic
913447193 1:118962012-118962034 CAGAAGAACTACAAGAAGCCAGG + Intronic
913583912 1:120254679-120254701 CAGAACGAAGGAAAGAAGGCAGG + Intergenic
913586012 1:120276609-120276631 TGGAAGAATGAAAAGCAGGTAGG + Intergenic
913622173 1:120621760-120621782 TGGAAGAATGAAAAGCAGGTAGG - Intergenic
913624260 1:120643641-120643663 CAGAACGAAGGAAAGAAGGCAGG - Intergenic
913999911 1:143684770-143684792 GGGAAGAAAGAAAAGAAGGTGGG + Intergenic
914215971 1:145628752-145628774 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914374765 1:147062971-147062993 GAGAAGAATGGAAAGAGGGAGGG - Intergenic
914468540 1:147951384-147951406 AAGAAGAATGGGAAGAAAGCTGG + Intronic
914503863 1:148271638-148271660 AGGAAGAAAGAAAAGAAGGTGGG - Intergenic
914565901 1:148866515-148866537 CAGAACGAAGGAAAGAAGGCAGG + Intronic
914568018 1:148888467-148888489 TGGAAGAATGAAAAGCAGGTAGG + Intronic
914604806 1:149241781-149241803 TGGAAGAATGAAAAGCAGGTAGG - Intergenic
914606924 1:149263733-149263755 CAGAACGAAGGAAAGAAGGCAGG - Intergenic
914857188 1:151361238-151361260 CAGAAGACTGAAAAGAATGTAGG + Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915294102 1:154908037-154908059 CAAAAGAGAGAACAGAAGGCAGG + Intergenic
915363858 1:155302666-155302688 AAAAAGAAAGAAAACAAGGCTGG - Intergenic
915388477 1:155518815-155518837 AGGAAGAAAGAAAAGAAGGAAGG + Intronic
915728245 1:158033975-158033997 CGGAAAAAAAAAAAGAAGGCTGG + Intronic
915847997 1:159289094-159289116 CAGAATAGTGGAAAGATGGCAGG - Intergenic
916045603 1:160997952-160997974 AAAAAGAAAGAAAAGAAAGCTGG - Exonic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916362614 1:163987957-163987979 CAGAAAAAAGAAAAGAGGGATGG + Intergenic
916410835 1:164545476-164545498 AAGATGGAGGAAAAGAAGGCTGG + Intergenic
916555722 1:165892730-165892752 CAGAAGAATGTAAAGGAGGGAGG + Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917609009 1:176667395-176667417 CAGAAAAATGAAAGGAAGTGGGG + Intronic
918067322 1:181110143-181110165 TTGAAGAATGAACAGAAGCCAGG + Intergenic
918216653 1:182397556-182397578 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
918237473 1:182594261-182594283 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
918317988 1:183339188-183339210 CAGAAGAATGACATGAACCCGGG - Intronic
918341428 1:183570873-183570895 CAGAAGAATGGAAACAGTGCTGG - Intronic
918355082 1:183700397-183700419 CAGAAAAATGGACAGAAAGCAGG + Intronic
918544320 1:185665131-185665153 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
918802016 1:188984816-188984838 AAGAAGAAAGGAAAGAAGGGAGG - Intergenic
918903359 1:190455603-190455625 CAGAATAATGAAAAAAAATCTGG - Intronic
919185558 1:194143210-194143232 AAGAAGAATGGAAGGAAGGAAGG - Intergenic
919348029 1:196411145-196411167 CAGAAGGAAAAAAAGAAGGAAGG - Intronic
919513257 1:198492875-198492897 GAGAAGAATCAAAAGAATGATGG - Intergenic
919656127 1:200199007-200199029 CAGCAGTATGAAGAGCAGGCAGG - Intergenic
919737311 1:200960757-200960779 CAGAAGGAGAAATAGAAGGCAGG + Intergenic
919819075 1:201461633-201461655 CAGAAGAATGAATTGAATTCTGG + Intergenic
919834453 1:201564109-201564131 AAGAAGAAAGGAAAGAAGGAGGG + Intergenic
920295144 1:204951559-204951581 CAGGAGAATGACAAGAACCCAGG - Intronic
920798165 1:209160715-209160737 CAGCAAAATGAAAAGATGGTAGG - Intergenic
920850482 1:209624963-209624985 AAAAAGAAGGAAAAGAAGGAAGG + Intronic
921263579 1:213404484-213404506 AGGAAGAAAGAAAAGAAGGGAGG - Intergenic
921360951 1:214330808-214330830 CAAAAGAATGAAAGGAAATCAGG - Intronic
921477930 1:215632718-215632740 TGGAAGAGAGAAAAGAAGGCAGG - Intronic
921553722 1:216570698-216570720 TAGAAGTGTGAAGAGAAGGCAGG + Intronic
921715275 1:218411423-218411445 CAGTAGAATGACTGGAAGGCCGG + Intronic
921840636 1:219824535-219824557 CATAACAATAAAAAGAACGCAGG + Intronic
922303433 1:224323673-224323695 CAGGAGGCTCAAAAGAAGGCAGG + Intronic
922308249 1:224363338-224363360 TAGAAAATTCAAAAGAAGGCTGG - Intronic
922438424 1:225629277-225629299 CGGAAGAAAGAAAAGAAGGCAGG + Intronic
922980677 1:229823878-229823900 CAGAAGAAAGCAGAGCAGGCAGG - Intergenic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923185470 1:231568862-231568884 TACAAAAAAGAAAAGAAGGCTGG - Intronic
923206293 1:231762176-231762198 GAAAAGAAAGAAAAGAAGGAAGG - Intronic
923509769 1:234640431-234640453 CAAAAGAAAGAAAGGAAGGAAGG + Intergenic
923523406 1:234753836-234753858 CAGAACAATTAAAAGGGGGCAGG - Intergenic
923762744 1:236862024-236862046 CAGCAGAAGGAAAACAAGGCTGG - Intronic
923799458 1:237193167-237193189 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
923988144 1:239404307-239404329 GAGAAGAAAGAAAGGAAGGAAGG + Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924052152 1:240090166-240090188 CAAAAGAAGGGAAAGAAGGAGGG - Intronic
924195921 1:241606773-241606795 ATGAAGAATGAAAATAAGACTGG + Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062940748 10:1419038-1419060 CAGAAAAATGAAACTAAAGCAGG + Intronic
1062983459 10:1744904-1744926 CAGAAAAATAAAAAAAATGCAGG + Intergenic
1063511268 10:6647220-6647242 CAGAGGAAGGGAAAGAAGGAAGG - Intergenic
1063953956 10:11248448-11248470 CTGAAGAATGGAAGGAAGGATGG - Intronic
1064210589 10:13357596-13357618 AAAAAGAAAGAAAAGTAGGCCGG - Intergenic
1064938460 10:20706448-20706470 CAGAAGATAGAACAGAAGGTTGG - Intergenic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065345690 10:24745976-24745998 CAGGAGAATGACGTGAAGGCGGG + Intergenic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065479227 10:26175996-26176018 TAAAAGACTGGAAAGAAGGCCGG + Intronic
1065497208 10:26341785-26341807 CAGGAGAATGGAAGGAAGGAAGG + Intergenic
1065497245 10:26341946-26341968 CAGGAGAATGGAAGGAAGGAAGG + Intergenic
1065886644 10:30083729-30083751 CATAAGAAAGAAAAGGTGGCTGG + Intronic
1065996791 10:31066884-31066906 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1066409216 10:35149739-35149761 AAGAGGAAAGAAAAGCAGGCTGG - Intronic
1066553418 10:36584582-36584604 AAGAAGGATGAAAAGTAGGAAGG - Intergenic
1066638605 10:37533014-37533036 CAGATGGACGAAATGAAGGCAGG - Intergenic
1066779814 10:38931927-38931949 AAGAAGGAAGAAAAGAAGGGAGG + Intergenic
1067161463 10:43828396-43828418 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1067453139 10:46394711-46394733 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1068081747 10:52326908-52326930 CACAAGACTGAAGAGAAGGAAGG - Intergenic
1068201421 10:53788595-53788617 AAGAAGAAAGAAAGGAAGGTAGG + Intergenic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1068292733 10:55025546-55025568 CAGAAGAATTATAAGAATGTAGG - Intronic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1068905022 10:62313034-62313056 CATAAGAATTAGAAGAACGCTGG - Intergenic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1068967907 10:62932140-62932162 AAAAAGAAAGAAAAAAAGGCTGG + Intergenic
1068978481 10:63036085-63036107 TATAAAAATAAAAAGAAGGCAGG + Intergenic
1069361445 10:67647355-67647377 CAGAAGAATGAAAAATATGTGGG - Intronic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070055787 10:72933373-72933395 TAGAAGTATCAAAAGATGGCCGG - Intergenic
1070302332 10:75212690-75212712 TAGAAGAATTAATACAAGGCTGG - Intronic
1070424310 10:76270607-76270629 AAGCAGAAGGAAAAGAAGACAGG - Intronic
1070852688 10:79580681-79580703 AAGGAGGATGAAAAGAAGGAAGG + Intergenic
1070977712 10:80618766-80618788 CAAAAGAAAGAAACGCAGGCAGG - Intronic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071052334 10:81466227-81466249 GAGAAGAATGAAATGAAGTTCGG + Intergenic
1071186229 10:83049193-83049215 GAGAAGAATGAGAAGAACACAGG - Intergenic
1071483783 10:86084307-86084329 CAAAAGAAAGAAAGGAAGGAAGG + Intronic
1071814849 10:89222198-89222220 CAGGAGGAGGAAAAGAAAGCTGG + Intronic
1071870040 10:89783844-89783866 TAAAATAATGAAAATAAGGCAGG + Intergenic
1071996536 10:91154390-91154412 CAAAAGAGTGAACTGAAGGCTGG + Intergenic
1072513692 10:96154450-96154472 GAAAAAAAAGAAAAGAAGGCAGG - Intronic
1072645444 10:97251058-97251080 CAAAAGAAAGAAAATAAGGAAGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073029658 10:100515451-100515473 CAGAATGATGGAAAGAAGGTAGG + Intronic
1073041008 10:100605484-100605506 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1073118451 10:101106884-101106906 GAGAAGAGAGCAAAGAAGGCGGG - Intronic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073411010 10:103341794-103341816 CATACTAATCAAAAGAAGGCTGG - Intronic
1073478987 10:103773735-103773757 TCAAAGAAAGAAAAGAAGGCTGG - Intronic
1073680579 10:105699147-105699169 CAGAGGGATGAAAGGAAGGAGGG + Intergenic
1073853457 10:107647884-107647906 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1073866406 10:107809444-107809466 AAGAAGAAAGAAAAGAAAGGGGG + Intergenic
1073909419 10:108323894-108323916 CAGAAGAATGGAAATAAAGTGGG + Intergenic
1074002732 10:109388685-109388707 AAGAAGGAAGAAAAGTAGGCAGG + Intergenic
1074050131 10:109874292-109874314 CAGAAGAAGGCAAAGAAAACAGG + Intronic
1074196801 10:111196097-111196119 CAGAAGAATGACATGAACCCGGG - Intergenic
1074344637 10:112671857-112671879 GAGAAGAAAGGAAAGAAGGAAGG - Intronic
1074344639 10:112671869-112671891 CAGAAGAAAGAAGAGAAGAAAGG - Intronic
1074485065 10:113868285-113868307 CAGAAGAAAGGAAAGAAGAGAGG - Intronic
1074631846 10:115265533-115265555 CTGGAAAAAGAAAAGAAGGCAGG - Intronic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1074804838 10:117038542-117038564 CAAGAGAATGAAAACAAGACTGG + Intronic
1074879301 10:117641206-117641228 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1075085610 10:119412524-119412546 CAGACCAAAGGAAAGAAGGCAGG - Intronic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075405344 10:122192110-122192132 CAGAAATATGAAAACAAGACAGG + Intronic
1075560304 10:123463386-123463408 AAGAAGGAAGGAAAGAAGGCAGG - Intergenic
1075762701 10:124869059-124869081 CAGACGGAGGAAAAGAAGGAAGG - Intergenic
1075892063 10:125960617-125960639 CAGAAGAATGACATGAACCCGGG - Intronic
1076038304 10:127220294-127220316 CAGGAGAATGAAGAGGAGGCAGG + Intronic
1076884034 10:133253239-133253261 CAAAAAAAAAAAAAGAAGGCTGG + Intergenic
1076968929 11:122186-122208 TAAAAGAGAGAAAAGAAGGCTGG + Intergenic
1077371565 11:2184486-2184508 CAAAAGAATTGAAAGAAGGCTGG - Intergenic
1077790096 11:5429732-5429754 CAGAAGCATGAAAGGAAGGGAGG + Intronic
1078899915 11:15632266-15632288 TAGAAGAAAGAAAAGAAGACTGG - Intergenic
1079141439 11:17812727-17812749 CAGTATAATGAAAAGTAGACTGG - Intronic
1079432374 11:20405105-20405127 AAGAAGGAAGAAAAGGAGGCTGG - Intronic
1079540924 11:21573750-21573772 AAGTAGAAAGAAAAGAAGGAAGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079835267 11:25326393-25326415 CATAAGAATCAAAGGAAGGCAGG - Intergenic
1080281190 11:30558721-30558743 AAGAAGGAAGAAAAGAAGGAAGG - Intronic
1080454825 11:32408550-32408572 AAGAAAAAAGAAAAGAAGGAAGG + Intronic
1080857296 11:36123385-36123407 CAGGAGAAAGAAAAGCAGGTAGG - Intronic
1081073355 11:38638025-38638047 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1081237365 11:40661215-40661237 GATAAGAGTGAAAAGAAAGCAGG - Intronic
1081283781 11:41244222-41244244 AAGAAGGAAGAAAAGAGGGCAGG + Intronic
1081318854 11:41665930-41665952 AAGAAGAGGGAAAATAAGGCTGG - Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1081477707 11:43451135-43451157 TAGAAGAATGAAAACGATGCAGG - Intronic
1081725076 11:45322330-45322352 GAGAAGAAAGAAGAGAGGGCAGG + Intergenic
1082743394 11:56936250-56936272 CAGAAGAGAGATAAGAAAGCAGG + Intergenic
1082756016 11:57077452-57077474 AAGAAGAAGAAAAAAAAGGCAGG + Intergenic
1082849876 11:57754931-57754953 AAGAAGAAAAAAAAGAAGGAAGG - Intronic
1082892734 11:58157527-58157549 AAGAAGGAAGAAAAGAAGGAAGG + Intronic
1083107142 11:60369156-60369178 AACAAGAAGGAAAAGAAGGACGG - Intronic
1083211013 11:61186133-61186155 TAAAAGAATAAAAAAAAGGCCGG - Intergenic
1083230148 11:61312154-61312176 CAGAGGAAGAAAAACAAGGCAGG + Intronic
1083411557 11:62496821-62496843 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1083606169 11:63980141-63980163 AGAAAGAAAGAAAAGAAGGCTGG - Intronic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1083956343 11:65985421-65985443 CAGAAGAATGAATAAATAGCCGG + Intergenic
1084705162 11:70811856-70811878 CAGAAAAATGATAAGATGGATGG - Intronic
1084898271 11:72291745-72291767 AAAAACAATGAAAAGCAGGCCGG + Intergenic
1085425152 11:76397972-76397994 CAAAAGTATGAAAAGTAGCCTGG + Intronic
1085668556 11:78439455-78439477 CAGAACAAAGAAAAGAAAGGGGG + Intronic
1086000648 11:81980842-81980864 CTGAAGAATAAAAACAAAGCTGG - Intergenic
1086170592 11:83831962-83831984 TGGAAGAATGAAAAGAGGGAGGG + Intronic
1086257860 11:84900971-84900993 AAGAAGAATAAAAGAAAGGCTGG - Intronic
1086386677 11:86316212-86316234 GAGGAAAAAGAAAAGAAGGCCGG + Intronic
1086816348 11:91377199-91377221 TAGAAGAATGAATAGATGGATGG + Intergenic
1086890263 11:92249483-92249505 AAAAAGAAAGAAAAGCAGGCAGG - Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1087083722 11:94196498-94196520 CAGAAGAGTAAACAGAAGCCTGG + Intergenic
1087195638 11:95301786-95301808 CAGAAGAATGAGGAGCAGGGAGG + Intergenic
1087569850 11:99912118-99912140 CTGAAGAATGTCAAGAAGGAAGG + Intronic
1087583979 11:100094676-100094698 AAGAAGAAAGAAATGAAGGAAGG + Intronic
1087599473 11:100294027-100294049 CTGAAGAATGAAAAGAGGGAAGG - Intronic
1087854131 11:103070370-103070392 CAGAAATATTAAAAGAAAGCAGG + Intronic
1087920627 11:103862738-103862760 AAGAGGAATGAAAAGAAGGAGGG - Intergenic
1088291671 11:108245346-108245368 CAAAAGAATTTAAAGAAAGCAGG + Intronic
1088374925 11:109130433-109130455 TAGAAGAATTAGCAGAAGGCAGG + Intergenic
1088440039 11:109860114-109860136 CAGGAGAATGGAAAGAATGCTGG - Intergenic
1088493814 11:110413108-110413130 CAAAAGAAAGAAGAGAAGGAGGG - Intergenic
1088552214 11:111024773-111024795 GGGAAGAAAGAAAAGAAGGAAGG + Intergenic
1088772253 11:113046855-113046877 CAGAAGAAAGAAAGGAAGGAAGG + Intronic
1088871393 11:113893324-113893346 CAGAAGAATGGCAAGAACCCGGG - Intergenic
1089883984 11:121801634-121801656 AAGAAGAAAGAAAGGAAGGTAGG + Intergenic
1090103520 11:123827413-123827435 GTGAATAATGAAATGAAGGCAGG - Intergenic
1090246995 11:125223524-125223546 TAGAAGTATTAAAAGAGGGCTGG - Intronic
1090437616 11:126699895-126699917 CAGATAAATAAAAATAAGGCCGG + Intronic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1091005270 11:131947523-131947545 AAGAAGGAAGAAAGGAAGGCAGG + Intronic
1091132601 11:133159057-133159079 CAGAAGAGAGAAGAAAAGGCAGG - Intronic
1091555954 12:1573707-1573729 CAGAAGAGTGAAATGAGGCCGGG + Intronic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1091826119 12:3514206-3514228 CAGAAAAAAAAAAAAAAGGCAGG - Intronic
1092001466 12:5036034-5036056 AAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1092252789 12:6910148-6910170 CAGAAGAAAGGAAGGAAAGCCGG - Intronic
1092369896 12:7908135-7908157 AAGAAGAGTGAAAAACAGGCCGG + Intergenic
1092961462 12:13600258-13600280 CACAAAAATGAAATGAAGGAAGG - Intronic
1093155783 12:15683480-15683502 AAGAAGAAATAAAAGAAGGAAGG - Intronic
1093269738 12:17045389-17045411 CAAAAGAATAAAAAGGAGGTAGG + Intergenic
1093270970 12:17061084-17061106 CAAAAGAATGTAAAGAATGAAGG + Intergenic
1093316886 12:17663409-17663431 TGGAAAAATGAAAAGAATGCAGG + Intergenic
1093643364 12:21554114-21554136 AAGAAGAATGGAAGGAAGGAAGG + Intronic
1093681297 12:22006585-22006607 CACAAACATGAAAAGAAGCCTGG - Intergenic
1094050028 12:26209008-26209030 AAGAAGAATAAAATGAAGGAGGG - Intronic
1094095631 12:26701108-26701130 AAGAAGAATATAAAGAAGTCAGG + Intronic
1094117215 12:26929746-26929768 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1094459579 12:30680104-30680126 AAGAAGAAGGAAAAGAAGAAGGG - Intronic
1094629896 12:32163242-32163264 TAAATTAATGAAAAGAAGGCAGG - Intronic
1094647455 12:32339587-32339609 AAAAAGAATGAAAGGAAGGAAGG - Intronic
1095170346 12:39027555-39027577 ATGAAGAATGGAATGAAGGCTGG + Intergenic
1095177467 12:39109965-39109987 GAGAAAAATCAAAAGAAGGATGG - Intergenic
1095602036 12:44024549-44024571 AGGAAGAATGGAAGGAAGGCAGG + Intronic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1095680754 12:44972848-44972870 AAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095703367 12:45213783-45213805 CATAAAAATGAGAACAAGGCCGG + Intergenic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1095857260 12:46873964-46873986 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1096163705 12:49402711-49402733 CAGATGAATGTAAAGAAGAAGGG + Intronic
1096641093 12:52994997-52995019 TAAATGAATGAAAAGAAGGCTGG - Intergenic
1096682686 12:53267323-53267345 AAAAAGAAAGAAAAGAAGGCCGG - Intergenic
1096757490 12:53812305-53812327 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1096910272 12:54976536-54976558 GAGAAGGAGGAAAAGAAGGAGGG + Intronic
1097212049 12:57378667-57378689 GAGAAGAATGAAAAATAGGCTGG - Intronic
1097265095 12:57739866-57739888 CAGAAGATTAAAGAGGAGGCAGG + Intronic
1097361832 12:58666711-58666733 CAGGAGAATGAAATGAACCCGGG - Intronic
1097430906 12:59505572-59505594 CTGAAAAATGAAGAGAAGGTTGG - Intergenic
1097543312 12:60967793-60967815 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1097926448 12:65133870-65133892 GAGAAGAAAGAAAGGAAGGGAGG + Intergenic
1097940539 12:65299775-65299797 CAACAAAATGTAAAGAAGGCTGG - Intronic
1097986305 12:65786376-65786398 AAGAAAAATGAAAAGAAGGAAGG - Intergenic
1098052179 12:66465875-66465897 AAGAAGAAAGAAAGGAAGGGAGG + Intronic
1098052184 12:66465903-66465925 AGGAAGAAAGAAAAGAAGGATGG + Intronic
1098435315 12:70462515-70462537 CAGAAGAATGAAAAAAGGGAGGG - Intergenic
1098537723 12:71613651-71613673 CAGAACACTGACAAGAAGCCAGG + Intronic
1098650649 12:72962979-72963001 AAGAAAAAAGAAAAGAAGGGAGG + Intergenic
1098958785 12:76716184-76716206 CAGAAAAATGAAAAGAGGCTGGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099243830 12:80170728-80170750 CAGTAATAAGAAAAGAAGGCTGG - Intergenic
1099294454 12:80812845-80812867 TAGAAGAATGAAGGGCAGGCTGG - Intronic
1099325072 12:81204424-81204446 AAGAAGAAATAAAAGAAGGGAGG - Intronic
1099602773 12:84762219-84762241 AAGAAGAAAGCAAAGAAGGAGGG + Intergenic
1099604795 12:84789986-84790008 CTGAAGAATGAAGAGAAGGTTGG + Intergenic
1099776279 12:87135547-87135569 GAGATGAAAGAAAAGAAGGGAGG + Intergenic
1099978085 12:89567358-89567380 CAACAGAATGGAAAGATGGCAGG + Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100517971 12:95346511-95346533 AAGAAGAATGCATACAAGGCTGG + Intergenic
1100665552 12:96748429-96748451 AAGATGAACGAAAAGAAGGAGGG - Intronic
1100814810 12:98375974-98375996 CATAAGAATGAAAACAGAGCTGG + Intergenic
1100872405 12:98923876-98923898 AAAAAGAATGAAGAGAAGGGAGG - Intronic
1101066420 12:101026920-101026942 CAAGAGAATGAAAAGAAGGGTGG + Intronic
1101743863 12:107522846-107522868 CAGAAAGATGCAAAGAAGGAAGG + Intronic
1101851165 12:108403514-108403536 CAGAAGAAGGAAAAAAGGCCAGG - Intergenic
1102074930 12:110052190-110052212 CAAAAAAAAAAAAAGAAGGCCGG - Intronic
1102657550 12:114495135-114495157 CAGAAGAAAGTAAAGGAGGTAGG - Intergenic
1103038182 12:117673233-117673255 TAAAAGAATGGAAAGAAGGAAGG + Intronic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103228108 12:119305251-119305273 CATTAGAGTGAAAAGAGGGCAGG + Intergenic
1103315666 12:120053074-120053096 TAAAAGAATGAAAATCAGGCTGG - Intronic
1103335814 12:120188754-120188776 CAGAAGAATGATATGAACCCGGG + Intronic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1103569495 12:121835353-121835375 AAAAAGAAAGAAAAAAAGGCCGG - Intergenic
1103694796 12:122805947-122805969 AATAAGAATTAAAATAAGGCTGG - Intronic
1103783551 12:123415507-123415529 CAGAAGGGAGAAAAGAAAGCAGG - Exonic
1103980504 12:124734084-124734106 CTCAAAAATAAAAAGAAGGCTGG - Intergenic
1104152826 12:126100922-126100944 AAGAAGAAAGAAAAAAAGGAAGG + Intergenic
1104386294 12:128354448-128354470 AGGAAGAAAGAAAAGAAGGCAGG - Intronic
1104910193 12:132236547-132236569 TAGAAGAAAGGAAAGAAGGTGGG - Intronic
1105031235 12:132885316-132885338 CAGAAGAATGGCAAGAACCCGGG + Intronic
1105234500 13:18535892-18535914 CAGAAGAATGGAAGAAAGGAGGG - Intergenic
1105865616 13:24456616-24456638 CAAAATAATGAAATGTAGGCCGG + Intronic
1105911003 13:24867320-24867342 CAAAAAAGTGAAAAGAAAGCTGG - Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106365547 13:29075954-29075976 CAGAAGAGTGAGAAGAAGATAGG + Intronic
1106548914 13:30754702-30754724 CAAATGAATGAAAATAAGTCAGG - Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107044064 13:35976621-35976643 CAGGAGAATGAAATGAACCCGGG - Intronic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107986805 13:45783290-45783312 GAGAAGAATAAAAAGGAGTCTGG + Exonic
1107993307 13:45837432-45837454 AAAAAGAATGAAAAAAAGGAAGG + Intronic
1108008111 13:45973472-45973494 CAGAAGCATGAAAAAAATACAGG + Intronic
1108065669 13:46575127-46575149 AACAGGAATGAAAGGAAGGCTGG - Intronic
1108086993 13:46803891-46803913 CATTAGAATGAAAGGAGGGCAGG + Intergenic
1108349549 13:49579325-49579347 TACAAGAATGAAAGGGAGGCCGG + Intronic
1108566156 13:51700297-51700319 CAGCTGAATGGAAAGAAGGAAGG + Intronic
1108680679 13:52777689-52777711 CAGAAGAATGACATGAACCCGGG + Intergenic
1109036181 13:57263501-57263523 TGGAAGTATGAAAAGAAGGAAGG - Intergenic
1109099399 13:58161277-58161299 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1109284333 13:60394359-60394381 TAGAAAAAAAAAAAGAAGGCTGG - Intergenic
1110261851 13:73493637-73493659 CATTAGAATGTAAATAAGGCTGG + Intergenic
1110277893 13:73660528-73660550 CAAAAGAAGGAAAAGAGGGTAGG + Intergenic
1110410222 13:75196636-75196658 CTGCAGAATCAAAACAAGGCAGG + Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1110931967 13:81231460-81231482 TGGAAGAATGAAAGGAAGACAGG - Intergenic
1111316815 13:86573399-86573421 GAGAAGAAAGAAAAGAAAGAGGG - Intergenic
1111446377 13:88349640-88349662 CAGGAGAATGGCATGAAGGCGGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112177409 13:97040256-97040278 CATGAGAATAAAAAGAAGGAAGG - Intergenic
1112200291 13:97268092-97268114 CAAAAGAAAGAAAGGAAGGAAGG - Intronic
1112230717 13:97586840-97586862 TCAGAGAATGAAAAGAAGGCTGG - Intergenic
1112350664 13:98630761-98630783 CAAAAAAAAGAAAAAAAGGCTGG - Intergenic
1112414902 13:99195907-99195929 CAAAAAAATGAAAAATAGGCCGG + Intergenic
1112584507 13:100706288-100706310 GAGAGGAAAGAAAAGAAGGAAGG - Intergenic
1112948485 13:104960612-104960634 ATGGAAAATGAAAAGAAGGCAGG - Intergenic
1112999115 13:105611584-105611606 CAGAAACATGACAAGAATGCAGG - Intergenic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1113112339 13:106837038-106837060 AAGAGGAATGAGAAGAAGGTTGG + Intergenic
1113641468 13:111960487-111960509 CAGATGAATGAATAGATGGATGG + Intergenic
1113813790 13:113158248-113158270 CAGGAGGATGGAAAGAAGGAAGG - Intergenic
1113858828 13:113467745-113467767 CAAAAGAATTAAAAGCGGGCCGG + Intronic
1114003113 14:18282876-18282898 GAGAAGAAAGAAAAGAAGGATGG - Intergenic
1114071756 14:19115689-19115711 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1114090503 14:19284275-19284297 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1114281787 14:21198902-21198924 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1114509250 14:23243397-23243419 AAAAAGAAAGAAAAGAAGACCGG + Intronic
1114742969 14:25117209-25117231 CAGAAGAGAGAAAAGTAAGCAGG + Intergenic
1114820178 14:26008968-26008990 CAGAAGAATGTAAAGGAAACAGG + Intergenic
1114999951 14:28410094-28410116 CAGAAGAAAAAAAAGAAAGGAGG + Intergenic
1115094865 14:29622380-29622402 CAGAAGGAAGGAAAGAAGGAAGG - Intronic
1115492249 14:33968695-33968717 CAGAAGGAAGGAAAGAAGGAAGG + Intronic
1115593605 14:34887709-34887731 GAGAAAAATGAAAAGAAGTTCGG - Intergenic
1115611355 14:35051411-35051433 CAAAAAAATAAAAATAAGGCTGG - Intronic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1116243873 14:42383016-42383038 GAGAGGAATGAGAAGCAGGCTGG - Intergenic
1116630013 14:47318751-47318773 TAGTAGAATGAAAAGGAGGGAGG + Intronic
1116925333 14:50629007-50629029 TAGAATAATAAAAAGTAGGCTGG - Intronic
1117218127 14:53573328-53573350 ATGAAGAATGAGAAGAACGCTGG + Intergenic
1117373354 14:55098842-55098864 CAGAAGAAAGGAAAGAAGTATGG + Intergenic
1117581475 14:57155886-57155908 CAAAAGAAAGAAATGAAGGAGGG + Intergenic
1117721196 14:58630450-58630472 CAGAACAATGAAAAGCAGAGGGG + Intergenic
1117795949 14:59394729-59394751 CAAAAGAAAGCAAGGAAGGCTGG - Intergenic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118561774 14:67092686-67092708 GAATAGAATGTAAAGAAGGCAGG + Intronic
1118583115 14:67324883-67324905 AAAAAAAATGAAAGGAAGGCTGG - Intronic
1119034486 14:71218157-71218179 CAAAAGAAAGAAAGGAAGGAAGG - Intergenic
1119190989 14:72681589-72681611 AAGATGGAGGAAAAGAAGGCAGG - Intronic
1119337178 14:73843648-73843670 CAAAAGAAAAAAAAGGAGGCGGG - Intergenic
1119386764 14:74262093-74262115 CAGAAGGATGGGAAAAAGGCTGG + Exonic
1119387788 14:74268658-74268680 AAGAAAGAAGAAAAGAAGGCAGG + Intergenic
1119622344 14:76140545-76140567 AAAAAGAAAGAAAAGAAGGAAGG + Intergenic
1119714001 14:76845338-76845360 AAGAAGAAGGAAAAGAAGAAGGG + Intronic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120284810 14:82486184-82486206 AAGATGAATGAATACAAGGCAGG + Intergenic
1120288175 14:82532336-82532358 AGGAAGAAAGAAAAGAAGGAAGG - Intergenic
1120325874 14:83025692-83025714 AAGAAGAACGGAAAGAAGGAAGG + Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120474468 14:84969824-84969846 CACATGAATGAATTGAAGGCTGG + Intergenic
1120499384 14:85275597-85275619 CAGAAGAATGTGTAGAAGGTAGG + Intergenic
1120698635 14:87672808-87672830 CAGAAGAATGGCAAGAACCCAGG + Intergenic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121029091 14:90642713-90642735 CAGAGGAAAGATAAGAAGGTAGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121509227 14:94500070-94500092 CAGATGAATGAACACCAGGCAGG + Intronic
1121624574 14:95374808-95374830 AAGAAGAAAGAAAAGAAGGAGGG - Intergenic
1121895072 14:97639349-97639371 GAGAAGAATGAATAGGAGGTCGG + Intergenic
1122031738 14:98917265-98917287 AGGAAGAAAGAAAAGAAGGGTGG - Intergenic
1122517786 14:102320453-102320475 CTGAAGAACGAACATAAGGCAGG + Intronic
1122611812 14:102989574-102989596 AAAAAGAATGAAGAGCAGGCCGG + Intronic
1122621645 14:103061128-103061150 AAGAAAAAGAAAAAGAAGGCCGG + Intergenic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1122948566 14:105027059-105027081 CAGAAGAGAGAAAGGAAGGGAGG + Intergenic
1202937446 14_KI270725v1_random:104309-104331 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1123388226 15:19841173-19841195 GAGAAGAAAGAAAAGAAGGACGG - Intergenic
1124035652 15:26051617-26051639 CAGATGAATGAATAGAAGGAGGG - Intergenic
1124038070 15:26074772-26074794 CAGAAGAATGGCAGGAAGCCAGG + Intergenic
1124078449 15:26469057-26469079 GAGATGAAAGAAAAGAAGGAAGG + Intergenic
1124266653 15:28241523-28241545 CAAAAGAAGTAAAAGCAGGCCGG + Intronic
1124781702 15:32642255-32642277 TAGAAGAATGATTAGAAGGAGGG + Intronic
1124984360 15:34591744-34591766 GAAAAGAAAGAAAAGAAGGAAGG - Intergenic
1125431889 15:39603651-39603673 CAAAAGAATGACAAGATGGATGG + Intronic
1125639790 15:41221002-41221024 AAGAAGAAAGAAGAGGAGGCTGG - Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1126208282 15:46071226-46071248 CAGAAGAAAAAATATAAGGCAGG - Intergenic
1126343088 15:47665306-47665328 AAGAAGAATGAAAAGGAAGATGG - Intronic
1126405104 15:48315370-48315392 CACAAGAACGAATAGAAGGGTGG + Intergenic
1126492016 15:49247447-49247469 GAGAAAAAAGAAAAGAAGGAAGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126650898 15:50920407-50920429 CAAAAAAAAAAAAAGAAGGCCGG - Intronic
1127129180 15:55844190-55844212 GAGAGGAAGGGAAAGAAGGCAGG + Intronic
1127149770 15:56061243-56061265 TAAAAAAAGGAAAAGAAGGCTGG + Intergenic
1127375065 15:58376820-58376842 CAGAAGAAAGGAAGGAAGGAAGG + Intronic
1127928917 15:63577458-63577480 CTGTACAAAGAAAAGAAGGCCGG + Intronic
1128068397 15:64778050-64778072 CTAAAAAAAGAAAAGAAGGCCGG - Intergenic
1128257251 15:66206339-66206361 AAGAAGAAGAAAAAGAAAGCAGG + Intronic
1128406526 15:67346083-67346105 AACAATAATGAAAAGAAAGCTGG + Intronic
1128894013 15:71356552-71356574 GAGAAGAATGGAGAGAAGGAAGG + Intronic
1129124962 15:73431526-73431548 GAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1129858915 15:78845085-78845107 AAGAAAAAAGAAAAGAAAGCTGG - Intronic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130042567 15:80417640-80417662 GAGAAGGAGGAAAAGAAGGAAGG - Intronic
1130043665 15:80427476-80427498 CTCAAGACTGAAAAGAAGGGAGG + Intronic
1130508448 15:84569457-84569479 CAGAAGCCTGAAAGGAAAGCGGG + Intergenic
1130610674 15:85358106-85358128 GAGAAAAATCAAAAGAGGGCAGG + Intergenic
1130969351 15:88720051-88720073 CAGAAGGAAAAAAAGAAGGAAGG - Intergenic
1131330654 15:91496092-91496114 CAGATTAATGGAAAGAAGGGAGG - Intergenic
1131408911 15:92189563-92189585 CATTACAATGAAAAGGAGGCAGG + Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131836748 15:96398586-96398608 AAGAAGAATGGAAAGAGGGCAGG - Intergenic
1131910621 15:97196330-97196352 TATATGAATGAAAAGAAGGCAGG + Intergenic
1132192492 15:99879235-99879257 CAAAAAACTGAAAAGAAGGGAGG + Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1133603319 16:7361143-7361165 CAGAAGCTTGGAAAGAGGGCTGG - Intronic
1133665761 16:7966289-7966311 CACAAGAGAGAAATGAAGGCTGG - Intergenic
1134104475 16:11476114-11476136 TAGGAGCATGGAAAGAAGGCTGG + Intronic
1134261420 16:12654240-12654262 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1134328653 16:13230117-13230139 GAGGAGACAGAAAAGAAGGCAGG + Intronic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134759900 16:16705086-16705108 TAGAAAAATGAAATGCAGGCTGG + Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1134986172 16:18654119-18654141 TAGAAAAATGAAATGCAGGCTGG - Intergenic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135181769 16:20281102-20281124 GAGAAGAATGGAAAGAGGGAGGG - Intergenic
1135348271 16:21707698-21707720 GAGAAGAAAGAAAGGAAGGAAGG - Intronic
1135394654 16:22122102-22122124 AAGAAGAAGGAAAAGAATGATGG + Intronic
1135491443 16:22913113-22913135 GAGAAGAAAGAAAGGAAGGAAGG + Intronic
1135770673 16:25216050-25216072 AAAAAGAAAGAAAAGAAGGAAGG - Intronic
1135914503 16:26593552-26593574 AGGAAGAAAGAAAAGAAGGAAGG - Intergenic
1135923566 16:26672625-26672647 CAGATGAATGAACAGAGGCCTGG - Intergenic
1136176344 16:28519608-28519630 CAAGAGAATGAAGAGAGGGCAGG + Intergenic
1136360339 16:29775358-29775380 AAGAAAAAAGAAAAAAAGGCCGG + Intergenic
1136491485 16:30611170-30611192 CAAAAAAATAAAAATAAGGCCGG - Intronic
1136524980 16:30823247-30823269 CATAAGAAAAAAAAAAAGGCTGG - Intergenic
1137218683 16:46426550-46426572 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1137254781 16:46765874-46765896 CCAAAGAATGAAAGGAAGGAAGG + Intronic
1137254824 16:46766144-46766166 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1137342177 16:47619216-47619238 CTGAAGAATGAAAGGAAGGAGGG + Intronic
1137408362 16:48207657-48207679 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137589992 16:49687568-49687590 AAAAAGAATGAAAGAAAGGCAGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138109009 16:54308371-54308393 AAGAAAAATAGAAAGAAGGCTGG + Intergenic
1138130460 16:54475158-54475180 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1138327169 16:56183991-56184013 CAGCAGAGTGAAAAGAACACTGG - Intergenic
1138506759 16:57482158-57482180 CAAAAGAAGAAAAAGAAGGCCGG - Intronic
1138541597 16:57691036-57691058 GAGAAGAAGGAAGAGAAGGAAGG + Intergenic
1138621159 16:58212503-58212525 AAGAAGGAAGAAAGGAAGGCAGG + Intergenic
1138910254 16:61388052-61388074 CAGAAGAATCATTTGAAGGCAGG - Intergenic
1138991624 16:62397206-62397228 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1139362514 16:66409596-66409618 CAGAAGAAAAGAAAGAAGGAAGG + Intergenic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139813200 16:69640981-69641003 CAAAAGAAAAAAAAAAAGGCCGG + Intronic
1139918230 16:70441164-70441186 TATAAAAAAGAAAAGAAGGCTGG + Intergenic
1140081703 16:71754248-71754270 GAGAAGAAAGAAAAGAAAGAAGG + Intronic
1140197723 16:72869097-72869119 GAGAAGACGGAAAGGAAGGCAGG + Intronic
1140347175 16:74225216-74225238 GATAAGAAGGAAAAGAAGACAGG + Intergenic
1140496540 16:75393960-75393982 CAGAAGAATGACATGAACCCGGG + Intronic
1140558051 16:75944294-75944316 CACAAGAAAGAAAACAAAGCAGG - Intergenic
1140688276 16:77454421-77454443 AAGAAGAAAGAAGAGAAGGAGGG + Intergenic
1140826168 16:78708914-78708936 CAGAAAAATAAAAAGAAGGCAGG + Intronic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1141118430 16:81331830-81331852 CAGAAGAACAAAGAGAAGGCTGG + Intronic
1141190905 16:81823967-81823989 AAAAAGAAGGAAAAGAAGGAAGG - Intronic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1142451747 16:90176936-90176958 TAAAAGAGAGAAAAGAAGGCTGG - Intergenic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1142708088 17:1709090-1709112 CAGCAAAATGAAGAGAGGGCCGG + Intronic
1142959136 17:3541712-3541734 TTGAGCAATGAAAAGAAGGCTGG - Intronic
1142999754 17:3785466-3785488 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1143556260 17:7662918-7662940 CAAAATAATGACAATAAGGCCGG - Intronic
1143684656 17:8504218-8504240 CACAAGGGTGAGAAGAAGGCTGG - Intronic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1143880888 17:10029150-10029172 TGCAAGAATAAAAAGAAGGCTGG + Intronic
1143949266 17:10619880-10619902 AAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1143970071 17:10789125-10789147 AAGGAGGATTAAAAGAAGGCTGG - Intergenic
1144006439 17:11104378-11104400 CAGAAGAATGGAAAGAATCTGGG + Intergenic
1144242733 17:13329286-13329308 AAGAAGAATAAAGGGAAGGCAGG + Intergenic
1144415128 17:15039180-15039202 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1144500400 17:15781545-15781567 AAGAAGTAAGAAAAGCAGGCCGG - Intergenic
1144608540 17:16689189-16689211 AAAAAGAAAGAAAAGAAGGAAGG - Intergenic
1145223991 17:21112582-21112604 AAAAAGAAAAAAAAGAAGGCAGG - Intergenic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1145709124 17:26952622-26952644 AAGAAGGAAGAAAAGAAGGGAGG + Intergenic
1145921418 17:28612987-28613009 CAGAACCAGGAAAAGAAGGTGGG + Intronic
1146494434 17:33308624-33308646 AAGATGAATGAAAAAAAGGAAGG + Intronic
1146585120 17:34075693-34075715 CTGAGGAATAGAAAGAAGGCTGG - Intronic
1147501966 17:40974493-40974515 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147501980 17:40974551-40974573 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1148058106 17:44814016-44814038 AAGTAGAATGAGTAGAAGGCAGG + Intronic
1148088999 17:45011467-45011489 AAGAAGAAAGAAAGAAAGGCCGG + Intergenic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148613612 17:48982184-48982206 CAAAAGAAAGAAAGGAAGGAAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149014102 17:51888190-51888212 GAGAAGAAAGGAAAGAAGGAAGG + Intronic
1149309487 17:55380133-55380155 AAGAAAAAGGAAAAGAAGGTAGG + Intergenic
1149436506 17:56638115-56638137 CAGAAATATGAAGCGAAGGCAGG - Intergenic
1149504172 17:57179562-57179584 AAGAAGAAAGGAAAGAAGGGAGG + Intergenic
1149509371 17:57226125-57226147 AAAAAAAAAGAAAAGAAGGCTGG - Intergenic
1149749234 17:59129478-59129500 CAAAAGAAAGAAAGGAAGGAAGG + Intronic
1150088511 17:62297974-62297996 CAGGAGAATGACAAGAACCCGGG - Intergenic
1150096998 17:62385810-62385832 CAGAAGAATGACATGAACCCAGG - Intronic
1150354118 17:64468786-64468808 TAAAAAAATGAAAAGATGGCCGG + Intergenic
1150716578 17:67577294-67577316 AATAAAAATAAAAAGAAGGCCGG + Intronic
1150801121 17:68283520-68283542 CAGAAAAAAAAAAAAAAGGCTGG + Intronic
1150848103 17:68679628-68679650 AATAAGAATGAAATGAAGGAAGG - Intergenic
1152328490 17:79656659-79656681 GAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1152366095 17:79857328-79857350 CACAAGAAAGAAAAGGATGCGGG - Intergenic
1152524739 17:80881520-80881542 TGAAAGAATGAAAAGGAGGCTGG + Intronic
1153086602 18:1295503-1295525 CAGAAGAATGAAAAGAGCAATGG - Intergenic
1153296538 18:3551775-3551797 CAAAAGAAAGAAAAAAAGGAAGG - Intronic
1153343665 18:4003355-4003377 GAAAAGAGAGAAAAGAAGGCAGG + Intronic
1153481961 18:5555878-5555900 AAGAGGAATGGAAAGATGGCTGG - Intronic
1153574240 18:6504719-6504741 CAGAAGGAAGGAAAGAAGGAAGG + Intergenic
1153757948 18:8302338-8302360 CTGAAGAACTAAAGGAAGGCTGG + Intronic
1154054112 18:10994702-10994724 TTAAAGAATGAAAAGTAGGCTGG - Intronic
1154072227 18:11163014-11163036 TTGAAGAATGAGAAGAAGACAGG - Intergenic
1154123083 18:11667246-11667268 CAGAAGGATGGAAAGAAAGGTGG + Intergenic
1154213472 18:12398798-12398820 GAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1154515044 18:15153966-15153988 CAGAAGAATGGAAGAAAGGAGGG + Intergenic
1154515835 18:15164567-15164589 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1154518875 18:15204875-15204897 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1154519129 18:15208139-15208161 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
1154534018 18:15378970-15378992 GAGAAGAAAGAAAAGAAGGACGG + Intergenic
1155447500 18:25927569-25927591 AAGAAGAGTGAAAAGAATTCTGG + Intergenic
1155481835 18:26297243-26297265 CCGAAGAACAAAGAGAAGGCTGG + Intronic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1156050605 18:32929091-32929113 TAGAAGCAAGAAAAGAAGGAAGG - Intergenic
1156222183 18:35063834-35063856 CAAAAAAATGAAAAGTAAGCTGG + Intronic
1156270981 18:35531682-35531704 CAGGAGAATGGCAAGAAGCCGGG + Intergenic
1156576556 18:38323804-38323826 AATAAGAAAGAAAAGAAGGTAGG + Intergenic
1156689981 18:39695936-39695958 CAGAAGCAAGAAAACAAGACAGG + Intergenic
1156721743 18:40078639-40078661 AAGAAGAAAGGAAAGAAGGCCGG + Intergenic
1156826282 18:41434047-41434069 CAAAAGAATGAAAAGAGAACAGG + Intergenic
1156908665 18:42384946-42384968 CAGAAGAAAGAAAGGAAGAAGGG - Intergenic
1156909311 18:42391943-42391965 CATAAGAAAGAAAGGAAGGAAGG - Intergenic
1156985352 18:43344560-43344582 CAAAACAATGGAAAGAAGGAAGG + Intergenic
1157021674 18:43790494-43790516 CAGAAGAAATCAAAGATGGCTGG - Intergenic
1157098811 18:44711378-44711400 GAGAGGAAGGAAAAGAAGGAAGG - Intronic
1157355529 18:46930517-46930539 TAGAAAAAAGAAAAGCAGGCCGG + Intronic
1157370982 18:47111534-47111556 AGGAAGAATGAAATGAAGTCTGG - Intronic
1157592913 18:48846552-48846574 CAGATGAATGAAAGGATGGATGG + Intronic
1157707412 18:49819073-49819095 CAAAAGAAAGAAAGGAAGGGAGG + Intronic
1157759382 18:50249219-50249241 AAAAAGAATAAAAAGAAGGCTGG + Intronic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1157868493 18:51207699-51207721 AAGAAAAATGAAAAAAAGGCTGG + Intronic
1158143400 18:54281799-54281821 CAGCAGAAAAAAAAGAAGGTTGG - Intronic
1158160566 18:54478312-54478334 TAAAAGAATGAAGAAAAGGCCGG - Intergenic
1158411885 18:57213193-57213215 CAGTAGACTGAAAAGAACACTGG + Intergenic
1158808907 18:61008003-61008025 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1158912102 18:62074803-62074825 GAGAACAATGAGAAAAAGGCTGG + Exonic
1159029625 18:63217973-63217995 TAGAAGAATGGAAAAAAGGAAGG + Intronic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159330379 18:66986643-66986665 AAGAAGAATCAAAAAAATGCTGG - Intergenic
1159529921 18:69642577-69642599 AATAAAAATGAAAAAAAGGCAGG - Intronic
1159657178 18:71045416-71045438 TAGGAGAAAGAAAAGAAAGCAGG - Intergenic
1159678278 18:71313608-71313630 CTGAAAAATAAAAATAAGGCTGG + Intergenic
1159679103 18:71325359-71325381 AAGAACAGTGAAAAGATGGCAGG + Intergenic
1159693703 18:71525970-71525992 AGGAAGAAAGAAAAGAAGGAAGG + Intergenic
1159706723 18:71698855-71698877 CAGAAGAATAATAAGAAAACAGG + Intergenic
1159874612 18:73796395-73796417 CAGGAGAATGGCATGAAGGCGGG + Intergenic
1160041258 18:75347743-75347765 AAGAAGAATGAAGAGAGGGAGGG + Intergenic
1160268892 18:77366108-77366130 CAGAAGAATGCAGTGCAGGCAGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160349486 18:78163445-78163467 GAGAAGAATGAAAAGTAGAGAGG - Intergenic
1160356179 18:78229776-78229798 GGGAAGGATGAAAAGAAGGTAGG - Intergenic
1160645734 19:192112-192134 TAAAAGAGAGAAAAGAAGGCTGG + Intergenic
1160931166 19:1570191-1570213 GAGAAGAAAGAAAAGAAAGAAGG - Intergenic
1161147067 19:2685325-2685347 ATGAAAAATGAAGAGAAGGCTGG + Intronic
1161158124 19:2745253-2745275 AAAAAGAAAGAAAAGAAGGAAGG + Intergenic
1161563985 19:4989287-4989309 CAGAAAAAAGAAAGGAAGACTGG - Intronic
1161589989 19:5125182-5125204 CACATTAATGAAAAGAAAGCTGG - Intronic
1161914404 19:7217853-7217875 CAAAAGAAAAAAAAGAAGGCCGG - Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1162059630 19:8086762-8086784 AATAAAAATGAAAATAAGGCTGG - Intronic
1162404364 19:10464699-10464721 AAGAAAAATGAAAACAAGGCCGG - Intronic
1162411200 19:10506674-10506696 CAAAAGAAAGAAAAAAAGGGTGG - Intergenic
1162415075 19:10531053-10531075 AAAAAGAAAGAAAAGAAGGATGG - Intergenic
1162517462 19:11157474-11157496 AAGAAGGAAGAAAAGAAGGCCGG - Intergenic
1162645774 19:12049172-12049194 AAGAATAACAAAAAGAAGGCTGG + Intronic
1162949984 19:14065520-14065542 AAAAATAATAAAAAGAAGGCTGG + Intergenic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1164019418 19:21285484-21285506 CATCAGAATAAAAATAAGGCTGG - Intronic
1164489540 19:28694048-28694070 CAGCAGAATGAAAAGAACAGAGG + Intergenic
1164491542 19:28719800-28719822 CATAAGAATTAAAAGATGGCTGG - Intergenic
1164570311 19:29369896-29369918 CAGAGGTAGGAAAGGAAGGCAGG + Intergenic
1164660534 19:29961978-29962000 CAGAAGAATCGAAAGCAGCCGGG - Intronic
1164663613 19:30004378-30004400 TAAAAGAATGAAAATAAGGAAGG - Intronic
1164916743 19:32058168-32058190 CAGAAGAAAGAAAGGAGGGAAGG - Intergenic
1164931190 19:32177546-32177568 AAAAAGAAGGAAAGGAAGGCAGG + Intergenic
1165294376 19:34914960-34914982 CAGAAAAATGAAAAGACAGAAGG + Intergenic
1165294421 19:34915293-34915315 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
1165752093 19:38266377-38266399 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
1166037014 19:40175906-40175928 TAGAAAAATAAAAAGCAGGCCGG - Intergenic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166223367 19:41379691-41379713 AAGCAGAAAGAAAGGAAGGCAGG + Intronic
1166228998 19:41414668-41414690 CAGATGAGTGAAAGGAAGGAAGG + Intronic
1166248165 19:41545845-41545867 CTGAAGAATGAAGAAAAGGGGGG - Intergenic
1166617973 19:44268332-44268354 AAGAAAAATGAAAAGAAAACAGG - Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167625529 19:50585942-50585964 CAGCAGAAAGAAAATCAGGCTGG + Intergenic
1167710361 19:51106811-51106833 CATAAGAATGGAAAGAAGCTGGG - Intronic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167874684 19:52401990-52402012 AAGAGGAAAGAAAAGAAGTCAGG + Exonic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168080532 19:54006829-54006851 CAAAATAAAAAAAAGAAGGCCGG - Intronic
1168081787 19:54015390-54015412 AGGAAGAAAGAAAAGAAGGAAGG - Intergenic
1168249808 19:55135392-55135414 GAAAAGAAAGAAAAGAAGGAAGG - Intronic
1168282643 19:55313617-55313639 AAGAAGGATGAAGAGAGGGCCGG - Intronic
1168373167 19:55853350-55853372 CAGAAGAATAAACAGAAGAATGG - Intronic
1168451996 19:56473978-56474000 CAAATGAAATAAAAGAAGGCTGG + Intronic
1168645766 19:58058184-58058206 CTGTAGAGTGAAAAGCAGGCTGG + Intergenic
1202682325 1_KI270712v1_random:18441-18463 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
925179118 2:1805453-1805475 GATATGAAAGAAAAGAAGGCCGG + Intronic
925236854 2:2286276-2286298 TAGAAGAATGAAGAACAGGCCGG - Intronic
925250395 2:2430895-2430917 CAGCAGAAGGAAGAGCAGGCTGG + Intergenic
925596396 2:5559378-5559400 TAGAAGGCTCAAAAGAAGGCAGG - Intergenic
925617233 2:5755193-5755215 CAGAAGAAGAGAAAGAAAGCAGG + Intergenic
925692035 2:6535335-6535357 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
925862241 2:8190475-8190497 AAGAAGAAGGAAAAGAATGAAGG - Intergenic
926026390 2:9548826-9548848 AAGAAGAATAAAAAGAAAACGGG + Intronic
926115865 2:10213037-10213059 GAAAAGAAAGAAAAGAAGGAAGG + Intergenic
926161894 2:10495134-10495156 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
926260465 2:11255621-11255643 CAGAAAAATGGAAACTAGGCCGG + Intronic
926654511 2:15386510-15386532 CGTAAAAATGTAAAGAAGGCTGG - Intronic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
927146736 2:20171116-20171138 GAGCAGAAGGAAAAGAGGGCAGG - Intergenic
927160204 2:20250241-20250263 CACAATAATAAAAAGAAAGCTGG + Exonic
927166622 2:20329528-20329550 CTGAAGAACAAAGAGAAGGCTGG + Intronic
927449880 2:23199435-23199457 CAGAAAGATGGAAAGAAGGGAGG + Intergenic
928046903 2:27943416-27943438 CAGAAGCAGGAAAGGAAGGCAGG - Intronic
928075166 2:28257879-28257901 AAAAAGAAAGAAAAGAAGCCGGG + Intronic
928644445 2:33337075-33337097 AACAAGTATGGAAAGAAGGCAGG - Intronic
928813115 2:35253689-35253711 CACATGAATGAAATGAAGGGTGG - Intergenic
929268663 2:39947699-39947721 CAAAAGAAAAAAAATAAGGCAGG - Intergenic
929362119 2:41104280-41104302 CAGGAGAAGGAAAAGAAAGAAGG - Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
930007983 2:46913407-46913429 AGGAAGAAAGGAAAGAAGGCAGG + Intronic
930315870 2:49796310-49796332 AACATGAAAGAAAAGAAGGCAGG - Intergenic
930665869 2:54097899-54097921 AAGAAGAAAGAAAGGAAGGAAGG - Intronic
931043207 2:58320391-58320413 CATAAAAATGAAAGAAAGGCCGG - Intergenic
931264660 2:60649945-60649967 AGGAAGAATGAAAGGAAGGAAGG + Intergenic
931764414 2:65442210-65442232 TAGAAAAAGGAATAGAAGGCCGG + Intergenic
931833733 2:66077795-66077817 TAGTAGGATGACAAGAAGGCAGG + Intergenic
932135131 2:69222173-69222195 AAGGAGAATGACAAGAAGACAGG - Intronic
932541689 2:72662043-72662065 AAGAAGAAAGGAAAGAAGGAAGG + Intronic
932600081 2:73117879-73117901 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
932631716 2:73350076-73350098 CTGAAGAAAGAAAACAAGGTGGG - Intergenic
932702555 2:74001725-74001747 CAGAAGACTGAAAGGAGGGCAGG - Intronic
932798360 2:74717060-74717082 AAGTAGAATGAAAACAAGTCAGG - Intergenic
932903018 2:75721843-75721865 AGGAAAAATGAAAAGAATGCAGG + Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933200091 2:79438154-79438176 CAGAAGGCTGCAAAGAAGCCTGG + Intronic
933407806 2:81883798-81883820 CAGAAGAATGAAAATAACTGAGG + Intergenic
933429038 2:82151168-82151190 AAGAAGGAAGAAAGGAAGGCAGG - Intergenic
933987870 2:87607841-87607863 CATTAGAGTGAAAGGAAGGCAGG - Intergenic
934060336 2:88286420-88286442 CAGAAGGATGAAAGGAGGACTGG - Intergenic
934602319 2:95666994-95667016 CAGAAGAATGTAATGGAGACAGG + Intergenic
934706095 2:96482480-96482502 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
934854604 2:97721504-97721526 CAGAAGAATGACATGAACCCAGG - Intronic
934903043 2:98176252-98176274 CAGAAGAAAGGAAGGAAGGAAGG - Intronic
935217425 2:100985293-100985315 CAGAAGGATGTATAGAAGGGAGG - Intronic
935305733 2:101734715-101734737 AAGAAGAAGCAACAGAAGGCAGG - Intronic
935647783 2:105355196-105355218 AAAAAGAAGGAAAAGAAGGAAGG + Intergenic
936305971 2:111342967-111342989 CATTAGAGTGAAAGGAAGGCAGG + Intergenic
936492423 2:112983662-112983684 CAGGAGAGTGGTAAGAAGGCAGG + Intronic
936523064 2:113224239-113224261 CAGATGAATTAAAAGATGGATGG + Intronic
936535682 2:113309148-113309170 CAGAAGAATGTAATGGAGACAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936648244 2:114396667-114396689 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
936658297 2:114513599-114513621 CAGAAGAAAGGAAGGAAGGGAGG + Intronic
936861629 2:117027019-117027041 GAGAAGAATAAAAATATGGCGGG - Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
936982321 2:118276237-118276259 AGGAAGAATGGAAAGAAGGAAGG - Intergenic
937099036 2:119254589-119254611 CACAAGAAAGACAAGACGGCGGG - Intronic
937487085 2:122326458-122326480 ATGAAGGATGAGAAGAAGGCTGG - Intergenic
937709979 2:124969407-124969429 AGGAAGAAGGAAAATAAGGCAGG - Intergenic
937845655 2:126576086-126576108 GAGATGAGTGAAAAGGAGGCAGG + Intergenic
937914309 2:127091508-127091530 CAGAAGTAGGAAATCAAGGCTGG + Intronic
938195741 2:129326069-129326091 AAGAAAAAAGAAAAGAAGGAAGG + Intergenic
938515307 2:131998748-131998770 CAGAAGAATGGAAGAAAGGAGGG + Intergenic
938518872 2:132045386-132045408 CAGAAGAATGTCATGAAGCCAGG - Intergenic
938532763 2:132206175-132206197 GAGAAGAAAGAAAAGAAGGACGG + Intronic
938532894 2:132207739-132207761 CAGATAAATGGAAAGAAGGGTGG + Intronic
938553811 2:132404857-132404879 CACATGAAAGAAAAGAAGGAAGG - Intergenic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
939068082 2:137507785-137507807 AGGAAGAATGAAAGGAAGGAAGG - Intronic
939160359 2:138581508-138581530 CAAAAGAATGAAAAACAGACGGG - Intergenic
939423448 2:142003640-142003662 CAGAGTAATGAAATGCAGGCAGG + Intronic
939473167 2:142651417-142651439 CAGAAGGCTGAAAAGAAGACAGG - Intergenic
939547940 2:143576669-143576691 CAGAAGAATCAGAAGAAGGGAGG + Intronic
939603470 2:144222807-144222829 CAGAAAAAAGAAAAGAAAGCTGG + Intronic
939636769 2:144591635-144591657 AAGATGAATGAAAAGAATGAGGG + Intergenic
939781098 2:146449096-146449118 CAGAAGGTAGAAAAGAAGGTTGG - Intergenic
940506792 2:154565616-154565638 CATAGAAGTGAAAAGAAGGCTGG - Intergenic
940604628 2:155904886-155904908 CATAAGAATGCTAGGAAGGCAGG - Intergenic
940653001 2:156456056-156456078 CAGTAGAAGGAAAAGAACACAGG - Intronic
940939477 2:159541914-159541936 CAAAAGAATGAAAGGAAACCAGG + Intronic
941391825 2:164924325-164924347 CTAAAGAATGGAAAGAAGGAGGG + Intronic
941415311 2:165213390-165213412 CAGAAGATTAAAATTAAGGCTGG - Intergenic
941687929 2:168466745-168466767 CAAAAGTAGGAATAGAAGGCAGG - Intronic
941791930 2:169561281-169561303 CAAAAGAAAAAAAAAAAGGCAGG + Intronic
942181553 2:173385428-173385450 ACGAAGAATGAAAAACAGGCCGG + Intergenic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942215465 2:173715016-173715038 CAGAAGAATTAAACAAAGGCAGG + Intergenic
942692255 2:178598512-178598534 AAGAAGAAGGAAAAGAAGAATGG - Exonic
943601136 2:189922655-189922677 TATAAGAACTAAAAGAAGGCAGG - Intronic
943920195 2:193697671-193697693 CAGACTAATGAAAAGAAAGCAGG - Intergenic
944340530 2:198591739-198591761 CAGATAAATGAAAATAAGGATGG - Intergenic
944673074 2:202012257-202012279 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
944785486 2:203065751-203065773 CAGAAAAAAAAAAAGAAGCCTGG + Intronic
944880120 2:204004474-204004496 CAAAAGAAAGAAAGGAAGGAAGG + Intergenic
945326163 2:208485292-208485314 GAGAGGAATGCAAAGAAGTCAGG - Intronic
945693977 2:213079505-213079527 GAGAAGAAAGGAAGGAAGGCAGG + Intronic
945752105 2:213800371-213800393 CAAAAGAAAGAAAAGAAGAAAGG - Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
946209528 2:218136212-218136234 CAAAAGAAAGAAAATCAGGCTGG + Exonic
946255459 2:218438566-218438588 CTCAGGAATGAAAAGAAGGCTGG - Intronic
947197896 2:227586885-227586907 CAGCACAGTGAAAAGAAGGCAGG + Intergenic
947314088 2:228836190-228836212 CAGAAGAAAAGATAGAAGGCGGG - Intergenic
947357824 2:229315613-229315635 CTGAAGAATTAAAATAAGTCTGG + Intergenic
948096585 2:235339673-235339695 CAAAAGAAAGAAAAGAAGGAAGG - Intergenic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948253947 2:236552474-236552496 CGCAAGAATGAAAAGGAGGGGGG - Intergenic
948403768 2:237702650-237702672 AAAAAGAAAGAAAAGAAGGAAGG - Intronic
948774510 2:240276630-240276652 CATAAAAATAAAAAGAAGGAAGG + Intergenic
948986422 2:241527464-241527486 AGAAAGAAAGAAAAGAAGGCCGG - Intergenic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1169717869 20:8640941-8640963 CAGAGGAATGTCAAGAAGACTGG + Intronic
1169770836 20:9198363-9198385 TAGAAGAAAGAGAAGAAGGTAGG + Intronic
1170113176 20:12827464-12827486 CAGAAGGAAAAAAAGAAGGAAGG + Intergenic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170723166 20:18901982-18902004 CAGATGGAAGAAAATAAGGCTGG + Intergenic
1171423821 20:25036995-25037017 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1171769614 20:29312468-29312490 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1171938466 20:31300107-31300129 CAGAAGAATAAAAGGAAAGATGG + Intergenic
1172584292 20:36071674-36071696 CAGAAGGAGGAAAGGAAAGCTGG + Intergenic
1172726965 20:37051930-37051952 AACATTAATGAAAAGAAGGCAGG + Intronic
1172804694 20:37603474-37603496 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1172825305 20:37778049-37778071 CAGCAGATTGAAAGGAAGGTTGG - Intronic
1173031151 20:39361476-39361498 CAGAACAATGGAAAGAAGTTTGG - Intergenic
1173071651 20:39774069-39774091 CATGAGAAGGAAAATAAGGCAGG + Intergenic
1173142206 20:40494337-40494359 CAGAGGAATGAAAGGGAGGGAGG - Intergenic
1173282441 20:41641436-41641458 CAGAAAAATGAACAAAAGGTAGG + Intergenic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174421097 20:50399647-50399669 GACAAGAGTGACAAGAAGGCAGG + Intergenic
1174463174 20:50697575-50697597 CAAAAAAATAAAAAGAAGGCCGG - Intergenic
1174684980 20:52446034-52446056 CAAATGAGGGAAAAGAAGGCAGG + Intergenic
1174818626 20:53708740-53708762 AAAAAGAAAGAAAAGAAGACAGG - Intergenic
1174843893 20:53924635-53924657 CAAAAAAATGAAAAGATTGCTGG + Intergenic
1174849022 20:53973787-53973809 CTCAAGAAAGAAAAGAAGGAAGG + Intronic
1176778486 21:13164177-13164199 CAGAAGAATGGAAGAAAGGAGGG - Intergenic
1177002094 21:15625670-15625692 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1177168786 21:17632774-17632796 CAGGAGAATGACATGAACGCGGG + Intergenic
1177282127 21:18994423-18994445 CAAAAGAAAGAAAGGAAGGAAGG + Intergenic
1177916180 21:27090551-27090573 CAAAAAAATGCAAAGAAGCCTGG - Intergenic
1177976109 21:27853191-27853213 CAGAAGAATGGAAGAAAGGAGGG - Intergenic
1177997512 21:28119750-28119772 CAGAAGTATGAAAATTAGCCGGG - Intergenic
1178076090 21:29014331-29014353 CAGAAGAAGAGAAAGAAGGCAGG - Intronic
1178279051 21:31265340-31265362 CAGAGGAATGACTAGAAGTCAGG + Intronic
1178357838 21:31923468-31923490 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
1178406429 21:32327254-32327276 CAGAAGAATGAAGATAAGAATGG + Intronic
1178607208 21:34049341-34049363 TAGAAGAATAAAAAGATGGAAGG + Intergenic
1179018604 21:37617212-37617234 AAAAAGAAAGAAAAGAAGGAAGG - Exonic
1179077322 21:38135015-38135037 CGGATGGATGAAAAGAAGGAAGG - Intronic
1179291283 21:40020356-40020378 CAAAACAAGGAAAAGAAGGAAGG - Intronic
1179632256 21:42685762-42685784 AAGAAAAAAGAAAAAAAGGCCGG - Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1180427628 22:15213677-15213699 GAGAAGAAAGAAAAGAAGGATGG - Intergenic
1180490195 22:15838044-15838066 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1180510881 22:16088076-16088098 GAGAAGAAAGAAAAGAAGGACGG - Intergenic
1180621076 22:17162450-17162472 AGGAAGAATGAAAGCAAGGCAGG - Intronic
1181469662 22:23130157-23130179 AAGAAAAAGAAAAAGAAGGCCGG + Intronic
1182106843 22:27695662-27695684 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182496842 22:30714910-30714932 CAAAAGAAACAACAGAAGGCTGG - Intronic
1182841671 22:33395586-33395608 CTAAAGAATGAAAATAGGGCAGG - Intronic
1182843469 22:33411036-33411058 CAGTAGAAGGGAAAGAAGGAAGG - Intronic
1183389003 22:37533135-37533157 AAGAAAAAAGAAAAGAAGGCGGG + Intergenic
1183435957 22:37795330-37795352 AAGAAGAAAAAAAAAAAGGCGGG - Intergenic
1183536197 22:38402835-38402857 GAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1183663388 22:39234222-39234244 CAGAGGAATCAACAGACGGCTGG - Intronic
1184003127 22:41689679-41689701 AAGAAGAAAAAAAAGAGGGCCGG + Intronic
1184324439 22:43772341-43772363 AAAAGAAATGAAAAGAAGGCCGG + Intronic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1185008797 22:48301548-48301570 CACAAGACTGAAGAGGAGGCCGG - Intergenic
1185092958 22:48786209-48786231 CAGCAGAGAGGAAAGAAGGCTGG - Intronic
1185122940 22:48983637-48983659 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1203290047 22_KI270735v1_random:27930-27952 AAGAAGGAAGAAAAGAAGGGAGG - Intergenic
949411921 3:3774883-3774905 AAGAAGAAAGAAAGGAAGGAAGG + Intronic
949677036 3:6467365-6467387 TAGAAGAATAAAATGAAGGAGGG + Intergenic
949714056 3:6907652-6907674 AAGAAGAATGAAAAGAAATAAGG + Intronic
949826720 3:8173292-8173314 CAATAGAATAAAAAGAATGCTGG + Intergenic
950132794 3:10558825-10558847 CAGGAGAAGGAAAGGAAGACAGG + Intronic
950203063 3:11058183-11058205 TAGATGAATGATGAGAAGGCCGG + Intergenic
950582137 3:13869543-13869565 AAAAAGAAAGAAAAGAAGGAAGG + Intronic
950603807 3:14059649-14059671 CAGAAATATGCAAAGATGGCTGG - Intronic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
951738078 3:25889747-25889769 AAGAAGGAAGAAAAGAAGGCAGG - Intergenic
951766067 3:26200649-26200671 CAGAAGGTTGAAAAATAGGCAGG - Intergenic
951797356 3:26554933-26554955 CATAAGAAAGAAAGGAAGGGAGG + Intergenic
951896158 3:27611841-27611863 CAGAAGGAAGAAAGGAATGCAGG - Intergenic
951974165 3:28484757-28484779 CAGAAGGAAGACAGGAAGGCAGG - Intronic
952117041 3:30195266-30195288 CAGAGGTATGAAAAGAAGACAGG + Intergenic
952165175 3:30740117-30740139 AAGAAGAAAGCAAAGCAGGCAGG + Intronic
952412102 3:33058609-33058631 TAGAAAAATGAAAAGAAAACAGG + Intronic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953203897 3:40803655-40803677 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
953241737 3:41155642-41155664 GAAAAGGATTAAAAGAAGGCAGG + Intergenic
953374176 3:42414641-42414663 CAGATTAATGAAACAAAGGCAGG - Intergenic
954336712 3:49922646-49922668 AAGAAGAAAGGAAAGAAGCCAGG + Intronic
954592609 3:51796498-51796520 CAGAAGGAAGGAAAGAAGGAAGG - Intergenic
954703414 3:52464962-52464984 CAAGAAAATGAAAAGATGGCCGG - Intronic
955304266 3:57814195-57814217 ACGATGAATGGAAAGAAGGCAGG - Intronic
955662630 3:61317309-61317331 GGGAAGAAAGAAAAGAAGGGAGG + Intergenic
955779233 3:62465635-62465657 CATAATAATGAAGAGAAAGCCGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
955954029 3:64269855-64269877 CACAATAAAGAAAGGAAGGCTGG + Intronic
955972636 3:64450987-64451009 CAGAAAAATGATACAAAGGCTGG - Intergenic
956094745 3:65704071-65704093 GAGAAGAGGGGAAAGAAGGCAGG + Intronic
956196319 3:66656616-66656638 CAGAAGAATTGAAAGCAAGCAGG - Intergenic
956357338 3:68408633-68408655 CTGAATAATGAAAGGAAGGAAGG - Intronic
956444294 3:69310355-69310377 CAGCATTATGAAAAGAATGCTGG + Intronic
956540878 3:70338389-70338411 CAGAAGAGTTAACAGCAGGCAGG + Intergenic
956593321 3:70939681-70939703 AAGAAGGAAGGAAAGAAGGCAGG - Intergenic
956597640 3:70985531-70985553 CCAATAAATGAAAAGAAGGCAGG + Intronic
956634514 3:71350537-71350559 GAGAAGAATGAATAGAAGGAAGG + Intronic
956675219 3:71725863-71725885 CAGAAGGATGGAGTGAAGGCTGG + Intronic
956726847 3:72163421-72163443 AAGAAGAAAGAAAGAAAGGCAGG + Intergenic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957347958 3:78985930-78985952 CCCAACAATGAAAAGAAGGAGGG + Intronic
957621535 3:82599337-82599359 CAGAAGAATGAAAAAGACCCTGG + Intergenic
957883191 3:86248601-86248623 CAGAAGAAAAAAAAAAAGGGGGG + Intergenic
958086324 3:88812735-88812757 CAGAGGAATGACTAGAATGCAGG + Intergenic
958111983 3:89159940-89159962 AGGAAGAAGGAAAAGAAGGAAGG - Intronic
958130952 3:89421342-89421364 AGGAAGAAAGAAAAGAAGGAAGG + Intronic
958137841 3:89519356-89519378 AAGAAAAAAGAAAAGAAGGGAGG - Intergenic
958564708 3:95795149-95795171 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
959380043 3:105630646-105630668 AGGAAGAAAGAAAAGAAGGAAGG - Intergenic
959440248 3:106365459-106365481 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
959456717 3:106571919-106571941 AAAAAGGAAGAAAAGAAGGCAGG + Intergenic
960022336 3:112969199-112969221 CAGAAGAATGAAGAGGAGAAAGG + Intronic
960099377 3:113723913-113723935 AAAAAGAAAGAAAAGAAGGGAGG + Intronic
960168947 3:114436263-114436285 CAGAAGAAAGGAAAGCTGGCTGG + Intronic
960281989 3:115790714-115790736 CAGAACAACAATAAGAAGGCTGG + Intergenic
960644566 3:119864966-119864988 CAAAAGAATAAAGATAAGGCAGG - Intronic
960897834 3:122523863-122523885 AATAAGAAAGAAAAGACGGCTGG - Intergenic
961112349 3:124295835-124295857 GACAAGAAGGAAAAGAAGACAGG - Intronic
961494820 3:127284016-127284038 CAGGTGGAAGAAAAGAAGGCTGG + Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
961950842 3:130747575-130747597 CAAAAGAAAAAAAAAAAGGCCGG - Intergenic
962020725 3:131498607-131498629 CAGAAGAATGGCAAGAACCCGGG + Intronic
962371424 3:134823860-134823882 CAGCAGAATGAGAAGAAAGCAGG + Intronic
962437783 3:135382644-135382666 CAGAAGGAAGGAAAGAAGGAAGG + Intergenic
962619621 3:137164584-137164606 GAGGAAAATGAAAGGAAGGCAGG + Intergenic
962719312 3:138157984-138158006 AAAAAGAAAGAAAAGAAGGAAGG - Intergenic
962728395 3:138256704-138256726 AACAAGAAGGAAAAAAAGGCCGG - Intronic
962772273 3:138623663-138623685 GTTAAGAATGAAAAGAAGGGTGG - Intronic
962852369 3:139317577-139317599 CAAAAGAATAAAAATAAGGGTGG + Intronic
962887855 3:139644280-139644302 CAAAAGAATGCAAATAAGACTGG + Intronic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963421696 3:145069282-145069304 AAGAAGAAAGAAAGGAAGGGAGG + Intergenic
963428651 3:145166600-145166622 CACAATACTGAAAATAAGGCAGG - Intergenic
963568228 3:146959332-146959354 TAGAAGAATGAACAGAGGCCTGG + Intergenic
963626355 3:147679024-147679046 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
964328685 3:155575984-155576006 AGGAAGAAGGAAGAGAAGGCAGG - Intronic
964374545 3:156036088-156036110 GATAAGAAGGAAAACAAGGCTGG - Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964692922 3:159473021-159473043 TAGAAAAATAAAAAGAATGCTGG + Intronic
965188545 3:165498999-165499021 AAGAAAAAAGAAAAGAAGGGAGG + Intergenic
965454051 3:168875314-168875336 AAAAAGAAAGAAAAGAAGGGAGG - Intergenic
965554444 3:170004972-170004994 CCCAAGATTGAAAGGAAGGCTGG + Intergenic
965581960 3:170278302-170278324 CAGCAGAGTGAAAAGAAACCAGG - Intronic
965798727 3:172468702-172468724 CAGAAGAATGAAGAGAACCTGGG + Intergenic
965808308 3:172565863-172565885 CAGGAGAATGAAATGAACCCGGG - Intergenic
965829323 3:172766446-172766468 CTGAAGAATGATTAGAAGGAAGG + Intronic
965907815 3:173731291-173731313 CTGAAGAATGGAAAGAAAGATGG + Intronic
965908135 3:173736220-173736242 AAGGAGAAAGAAAAGAAGGTAGG - Intronic
966260221 3:177968527-177968549 AAGACTAATGAAAAGAAGGCTGG + Intergenic
966428064 3:179802236-179802258 AAGAAAAAAGAAAAGCAGGCTGG + Intronic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966876113 3:184322709-184322731 CAGAAGTATGAATATAAGTCAGG + Exonic
967326743 3:188248285-188248307 TAGAAGCATAAAAAGAAGGCAGG - Intronic
967414948 3:189206031-189206053 CAGAAGAAAGGAAGGAAGGAAGG - Intronic
967690922 3:192472645-192472667 CAGAGGAATGAAGAGTAGGAAGG + Intronic
967814362 3:193786789-193786811 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
968211715 3:196854485-196854507 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
968361284 3:198148670-198148692 CAGAAGAATGGACAGAGGGACGG + Intergenic
968371947 3:198227414-198227436 TAAAAGAGAGAAAAGAAGGCTGG - Intergenic
968439541 4:615975-615997 CAGAAGAAAGGAAGGAAGGAAGG - Intergenic
968563047 4:1295108-1295130 CACCAGAATGAAGACAAGGCCGG + Intronic
968791649 4:2668757-2668779 GAAAAGAAAGAAAAGAAGGCAGG - Intronic
968863191 4:3189283-3189305 CAAAAGAATGGAAAGCAGGGTGG + Intronic
969106798 4:4812383-4812405 AGGAAGAATGGAAAGAAGGAAGG + Intergenic
970336058 4:15044120-15044142 CTGAAGCATGAAAAAAAAGCTGG + Intronic
970491964 4:16583982-16584004 AAAAAGAATGGAACGAAGGCAGG + Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
971303114 4:25457975-25457997 CACAAAAATGAAAAGCTGGCAGG - Intergenic
971317893 4:25582608-25582630 ATGAAGAAGGAAAAGAAGACGGG - Intergenic
971328396 4:25662914-25662936 CAGAACAATGAAAAGGGGGAGGG - Intronic
971355536 4:25891449-25891471 GAGAAGAAAGAAAAGCAAGCGGG - Intronic
971454223 4:26828919-26828941 CAGGAGAATGGAAAGAACTCAGG + Intergenic
971497894 4:27287367-27287389 AAGAAGGAAGAAAAGAGGGCAGG + Intergenic
971508863 4:27399185-27399207 CAGCAGGAAGAAATGAAGGCTGG + Intergenic
971909582 4:32778353-32778375 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
972789497 4:42357357-42357379 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
972915981 4:43880434-43880456 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
972950530 4:44316883-44316905 CAGAAGAATGACATGAACTCAGG + Intronic
973066037 4:45794433-45794455 CACAAAAAAGAAAAGAAGGGAGG + Intergenic
973124462 4:46567016-46567038 CAGAAGAAAGGAAGGAAGGAAGG + Intergenic
973320635 4:48806898-48806920 AAAAAGAAAGAAAAGAAAGCTGG - Intronic
973547483 4:51996092-51996114 CAGATGAATGGGAGGAAGGCGGG + Exonic
973661776 4:53115067-53115089 CAGAAGAATGAAAATTAGAAGGG + Intronic
973976479 4:56267968-56267990 CACAAGGATGAGAAAAAGGCTGG - Intronic
974301668 4:60076899-60076921 GAGAAGAATGAAGAGAAAGACGG + Intergenic
974436125 4:61859117-61859139 CTGAAAAATACAAAGAAGGCTGG - Intronic
974522667 4:63004708-63004730 CATAAGAAGGAAAATATGGCAGG - Intergenic
974531217 4:63110268-63110290 CAGAAGAAAGAAAGGAAGCGAGG + Intergenic
974575571 4:63715701-63715723 CAGAAGACTGAAGGGAAAGCAGG + Intergenic
974845671 4:67348609-67348631 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
975039578 4:69728655-69728677 CGGAAGAATGGAAGGAAGGAAGG + Intronic
975163182 4:71147334-71147356 GAGGAGGATGAAAAGAAGACAGG - Intergenic
975226232 4:71876201-71876223 GAGAAGAAAGGAAAGAAGGGAGG - Intergenic
975228470 4:71902948-71902970 AAAAAGAAGGAAATGAAGGCAGG - Intergenic
975350912 4:73345135-73345157 CAAAATAAAGAAAAGAAGGATGG + Intergenic
975373776 4:73619312-73619334 CTGAAAAATGGAAAGAAGCCAGG + Intronic
975493892 4:75017015-75017037 CTGAAGAATTGAAAGAAGACAGG - Intronic
975609673 4:76191697-76191719 GAGAAGAAAGAAAAGAAAGAGGG - Intronic
975647098 4:76555887-76555909 AAGAAAAAAGAAAAAAAGGCAGG - Intronic
975686379 4:76919790-76919812 CAGAAGAAAGAAAGGAAGAAAGG - Intergenic
975775713 4:77784778-77784800 CAAAAAAGTGGAAAGAAGGCTGG - Intronic
975866102 4:78725364-78725386 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
975891347 4:79032413-79032435 CAGAAGAAAGAAGAAAAGGAAGG - Intergenic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976295860 4:83471362-83471384 CAGAAGAAAAAAAAAAAGCCGGG - Intronic
976334059 4:83865235-83865257 CAGAAAACTTAAAAGAAGGCGGG - Intergenic
976500336 4:85780466-85780488 TACAAGAATTAAAAAAAGGCTGG - Intronic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977564637 4:98568558-98568580 CAAAAAAAAGAAAAGAAGTCTGG + Intronic
977844020 4:101745312-101745334 CAGGAGAATGAAATGAATCCAGG - Intronic
978313022 4:107407166-107407188 CAGAAAAAAGAAAGAAAGGCTGG + Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978777828 4:112520649-112520671 CAGAAAGATGGAAAGATGGCGGG + Intergenic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979366047 4:119824782-119824804 TATAAAAATGAAAAAAAGGCTGG - Intergenic
979602149 4:122597932-122597954 CACAAGAATAAAAAGCAGACGGG - Intergenic
979784101 4:124693375-124693397 CAGAAAAATCAATAGATGGCAGG + Intronic
980078623 4:128320528-128320550 AAGAAGAAAGAAAGGAAGGAGGG - Intergenic
980267364 4:130534941-130534963 AAGAAGAATGGAAGGAAGGAAGG + Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980603329 4:135055544-135055566 AGGAAGAATGAAAGGAAGGAAGG - Intergenic
980652236 4:135733101-135733123 CAGAAGATCGTAAAGAGGGCTGG + Intergenic
980838271 4:138224785-138224807 AGGAAGAAGGAAAAGAAGGAAGG + Intronic
980954084 4:139410532-139410554 GAAAAGAATGAAAGGAAGGAAGG + Intronic
980999938 4:139819086-139819108 AATAAGCATGAAATGAAGGCAGG + Intronic
981602536 4:146506790-146506812 AATAAGATTGAAAAGATGGCAGG - Intronic
981864013 4:149392673-149392695 CAGAAGCCTGGAAAGAAGCCAGG + Intergenic
981881612 4:149619858-149619880 CAGAAGAAAGACAACATGGCCGG + Intergenic
981904477 4:149905106-149905128 CAGAGGAATAAAAAAAGGGCTGG - Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982235667 4:153249256-153249278 CAGGCGGAAGAAAAGAAGGCGGG - Intronic
982554718 4:156844625-156844647 TAAAAGAATGGAAAGAATGCCGG + Intronic
982950871 4:161693932-161693954 TAAAAGAATTACAAGAAGGCTGG - Intronic
983624896 4:169792314-169792336 CAAAAGAAAAAAAAGAAGCCAGG + Intergenic
983741788 4:171143420-171143442 CAGAAGAAAGAAAAGACACCCGG + Intergenic
983906348 4:173186537-173186559 AAGAAGAAGGAACAGAAGGAAGG - Intronic
983951065 4:173641987-173642009 AAGATCAATGAAAAGAAGGTAGG + Intergenic
984048738 4:174836996-174837018 TAGAAGAATAAAAATATGGCTGG + Intronic
984123292 4:175772547-175772569 CAGCAGAATGACAGGAAGGAAGG - Intronic
984316815 4:178139931-178139953 CAGCAGAATTATAAGAAGTCAGG + Intergenic
984453375 4:179932578-179932600 AGGAAGGATGAAAAGAAGGAAGG + Intergenic
984834179 4:184003889-184003911 AAGAAGAAAGGAAAGAAGGCAGG - Intronic
984850123 4:184145304-184145326 AGGAAGAAAGAAAAGGAGGCAGG - Intronic
985208027 4:187561587-187561609 CAGAAGAATGAAAAAAAACTTGG - Intergenic
985397917 4:189564339-189564361 CAGAGGAATGAAGATAAGGATGG + Intergenic
985860642 5:2467928-2467950 GAGAAGGATGAAGAGGAGGCAGG - Intergenic
985969054 5:3361103-3361125 CACAAGAATGAAAACAGGCCAGG + Intergenic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
985971210 5:3380106-3380128 CACAAAAATAAAAATAAGGCTGG + Intergenic
986058739 5:4166326-4166348 GAAAAGAAAGAAAAGAAGGAAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986817089 5:11424811-11424833 AACAAGAAAGAAAAGAAGGAAGG + Intronic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987254445 5:16135835-16135857 CACAGGAAAGAAAGGAAGGCGGG + Intronic
987388200 5:17350364-17350386 GAAAAGAAAGAAAAGAAGGAAGG - Intergenic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987759066 5:22135637-22135659 CTGAAGAATGAAGAGAAGGCTGG + Intronic
988213325 5:28237823-28237845 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
988452623 5:31358690-31358712 GAAAAGAAAGAAAAGAAGGAAGG - Intergenic
988496241 5:31748593-31748615 CAGAAGGATGGCCAGAAGGCAGG - Intronic
988979974 5:36557688-36557710 AAGAAAAATGAAAACATGGCTGG - Intergenic
989278008 5:39610974-39610996 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
989607127 5:43255452-43255474 GATAAGAAAGAAAAGAGGGCCGG + Intronic
989781444 5:45269795-45269817 CAGAAGACAGAACAGAAAGCGGG - Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990352691 5:54934695-54934717 GGGAAGAATGAGAAGAAAGCAGG + Intergenic
990690041 5:58353827-58353849 CAGAAGAAAGGAAAGAAAGGAGG + Intergenic
990903849 5:60781502-60781524 CAGTAGAAAGAAAACAAGCCAGG + Intronic
991020485 5:61974694-61974716 TAGAAGCATGAAAACAATGCAGG + Intergenic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991076777 5:62548629-62548651 AAGAAGAAAGAAAATAAGACTGG - Intronic
991354217 5:65750775-65750797 AAGAAGAAAGAAAAGAAGGAAGG + Intronic
991492939 5:67200963-67200985 AAGCAGCATGACAAGAAGGCAGG - Intergenic
991893778 5:71369083-71369105 CTGAAGAATGAAGAGAAGGCTGG + Intergenic
992575547 5:78106813-78106835 TGGGAGAATGAAAAGAATGCTGG + Intronic
993012338 5:82497841-82497863 AAAAAGTAAGAAAAGAAGGCAGG + Intergenic
993525294 5:88957959-88957981 GAGAATAAAGAAAAGAAAGCAGG - Intergenic
993852684 5:93030896-93030918 GAGAAGAAAGGAAAGAAGGAAGG + Intergenic
994196603 5:96929480-96929502 AAGAAGAAAGAAAGGAAGGAAGG - Intronic
994483979 5:100372241-100372263 AAGAAAAATAAAAAGAAGGGAGG + Intergenic
994668503 5:102737268-102737290 GAGAAGAAAGAAAAGAAGGAAGG + Intergenic
994752641 5:103757592-103757614 CAGAAGCATGATGAGAAGGTAGG + Intergenic
994791325 5:104230101-104230123 TAGAAGCATGCAAAGCAGGCAGG - Intergenic
994834028 5:104825590-104825612 CTTAATAATGAAATGAAGGCTGG + Intergenic
994889896 5:105620049-105620071 CAGGAGAAAGAAAATAGGGCAGG - Intergenic
995400913 5:111740457-111740479 CAAAAGAAAGGAAAGAAGGAAGG - Intronic
995448566 5:112274444-112274466 CAGAAGAATAAGAAGAGGGTAGG - Intronic
995506741 5:112868694-112868716 AATAAAAATGTAAAGAAGGCCGG - Exonic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996091494 5:119356104-119356126 CAGAAGAATCCAAGGAAGGTAGG + Intronic
996435357 5:123428128-123428150 CACAAAAATTAAAAGAAGCCAGG - Intergenic
997100586 5:130964547-130964569 CAGAAAAATGATGAGAAGACTGG - Intergenic
997224948 5:132202892-132202914 CAGAACAAAGAAAGAAAGGCGGG - Intronic
997254986 5:132421647-132421669 CAGATGAGAGAAAAGAAGGTGGG + Intronic
997461491 5:134055510-134055532 CAGGAGAATGACAAGAACCCGGG - Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997804628 5:136905025-136905047 AAGAAGAAAGAAGAGAAGGAAGG - Intergenic
997806925 5:136927345-136927367 CAGAAGAATGAAGAAAAAGCTGG - Intergenic
997831415 5:137153888-137153910 AAGAAGAAAAGAAAGAAGGCAGG + Intronic
998228313 5:140343620-140343642 CTGAAGCATGGAAAGAAGGAGGG - Intronic
998730867 5:145075458-145075480 CAGTAGAATGATTAGAAGGCAGG + Intergenic
998809621 5:145953293-145953315 CTGAAGGATGAGAGGAAGGCAGG + Intronic
998831882 5:146168399-146168421 CAGAAAACTGAAACGGAGGCTGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998929276 5:147162772-147162794 ATGAAGAATGAAAAGAACACTGG - Intergenic
999274873 5:150323527-150323549 AAGAAGAATGAGCTGAAGGCAGG - Intronic
999285868 5:150393916-150393938 CAGAAGAATGACTTGAAGCCAGG + Intronic
999390517 5:151186348-151186370 AAGAGGAAAGAAAAGAAGACGGG + Intronic
999524491 5:152389176-152389198 GAGAAGAATGAGAAGAGGGAGGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999593691 5:153178106-153178128 CAGAAGGATGAAAATAAAGAAGG - Intergenic
999716964 5:154369090-154369112 CACAAGAATGAAATGAGGCCAGG + Intronic
1000083947 5:157872823-157872845 CAAGAGAATTAAAAGTAGGCTGG + Intergenic
1000209815 5:159098684-159098706 AAGAAGAAAGAAAAGAAGGCAGG + Intronic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1000813656 5:165892821-165892843 CAGAAAAATGAAACCAAGCCAGG - Intergenic
1000931363 5:167255528-167255550 AACAAGAAGGAAAAGAGGGCAGG - Intergenic
1001125407 5:169014588-169014610 CACAGGAATGAAGAGAAGGAAGG + Intronic
1001477864 5:172063937-172063959 GCAAAGGATGAAAAGAAGGCTGG + Intronic
1001715173 5:173809697-173809719 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1001743194 5:174070490-174070512 AAGAAGGAAGGAAAGAAGGCAGG - Intronic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002550515 5:179987150-179987172 TAGAAGAAAGAAAGGAAGGAAGG - Intronic
1002731186 5:181332960-181332982 TAAAAGAGAGAAAAGAAGGCTGG - Intergenic
1003228560 6:4228731-4228753 TAGAAAAATGAGTAGAAGGCTGG + Intergenic
1003584284 6:7372560-7372582 CAAAAGAACCACAAGAAGGCAGG + Intronic
1003672924 6:8176480-8176502 AAAAAGAAAGAAAAGAAGGAAGG - Intergenic
1003750952 6:9055376-9055398 CAACAGAAAGCAAAGAAGGCAGG + Intergenic
1003902613 6:10668796-10668818 GAGAACAAAGAAAAGAAGGGTGG - Intergenic
1003972617 6:11313497-11313519 CAGATGAATGAATAGATGGATGG + Intronic
1004528386 6:16430292-16430314 AACAACAATGAAAAGAAGGCAGG + Intronic
1004779171 6:18887205-18887227 AGGAAGAATGGAAAGAAGGAAGG - Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1004921988 6:20384364-20384386 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005073396 6:21883561-21883583 AAGGAGAATGATCAGAAGGCAGG - Intergenic
1005148222 6:22717312-22717334 GAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1005500932 6:26428589-26428611 CAGAAGAACTAAAAGAAGTCGGG - Intergenic
1005505506 6:26465897-26465919 CAGAAGAACTAAAAGAAGTTGGG - Intronic
1005555624 6:26979366-26979388 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1006081402 6:31569494-31569516 TAAAAGAATGAGAAGAAGGTTGG + Intergenic
1006239543 6:32665236-32665258 CAGAAGCCCGCAAAGAAGGCGGG - Intronic
1006498555 6:34441904-34441926 CAAAAGACTGAAGAGTAGGCTGG - Intergenic
1006705545 6:36017188-36017210 AAGAAGAATGGAAGGAAGGAAGG + Intronic
1006716563 6:36124175-36124197 AAAAAGAACGAAAGGAAGGCAGG - Intergenic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006753175 6:36392370-36392392 TAGAAGAATGGAGAGAAGACTGG + Intronic
1006851929 6:37104674-37104696 CTGAAGAGTGACAACAAGGCTGG - Intergenic
1007042090 6:38732010-38732032 CATAAGAAAGAAATGTAGGCTGG - Intronic
1007048946 6:38806237-38806259 AAAAAGAATGAAAAGAAGGTGGG - Intronic
1007334379 6:41141804-41141826 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1007493493 6:42242966-42242988 CAGAAGAATTAAACCAAGGATGG - Intronic
1008035324 6:46739129-46739151 GATAAGAATGAAAGGAGGGCTGG + Intergenic
1008333519 6:50271966-50271988 AGGAAGGATGAAAAGAAGGGAGG + Intergenic
1008369554 6:50716485-50716507 AAGAAGGAAGGAAAGAAGGCAGG + Intronic
1008443150 6:51556044-51556066 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1009377290 6:62988706-62988728 AACAAGAAAGAAAAGAAGCCTGG - Intergenic
1009512392 6:64569444-64569466 AAAAAGAATGAAAAGGAGCCGGG + Intronic
1009751888 6:67886081-67886103 CAGATGGATGAAAAGAAAGCAGG + Intergenic
1009882368 6:69584356-69584378 AAGAACAATGGAAAGAAGGAAGG + Intergenic
1010104964 6:72156441-72156463 CAGAAGAATGATTACTAGGCAGG + Intronic
1010244432 6:73650211-73650233 AAAAAGAAAGAAAAAAAGGCCGG + Intronic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011001056 6:82588916-82588938 AGGAAGAAAGAAAAGAAGGAAGG + Intergenic
1011016492 6:82761616-82761638 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1011239023 6:85250859-85250881 CAAAAGAATGGAGAGAAGGAGGG + Intergenic
1011312723 6:85998234-85998256 CAGAAAAATAAAATGAAGGAAGG + Intergenic
1011695137 6:89905791-89905813 CACACTAATCAAAAGAAGGCAGG - Intergenic
1011857874 6:91717220-91717242 AAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1012151959 6:95764917-95764939 TAGAAGAGTGAATAGATGGCAGG + Intergenic
1012268237 6:97173916-97173938 CAAAAGAATCAAGAGAAGACTGG + Intronic
1012532339 6:100252608-100252630 CAGAAGAAAGGAGAGAAGGAGGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012734208 6:102918108-102918130 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012869555 6:104657482-104657504 AAAAAGAATGAAAAGAGGCCGGG + Intergenic
1012982806 6:105847619-105847641 GAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1013062041 6:106644166-106644188 GGAAAGAAAGAAAAGAAGGCCGG - Intronic
1013126030 6:107185297-107185319 TGAAAGAATGAACAGAAGGCAGG + Intronic
1013238603 6:108222051-108222073 AACAAAAATGTAAAGAAGGCCGG - Intronic
1013775232 6:113672253-113672275 AAGAAGAAAGAAAGGAAGGGAGG + Intergenic
1013830873 6:114271284-114271306 AAGAAGAAAGAAAAGAAACCAGG - Intronic
1013841343 6:114398125-114398147 TGGAAGAATGAAAAGAAGGAAGG - Intergenic
1014094650 6:117446716-117446738 CAGAAGAATGAAGAAAACTCAGG - Intronic
1014138201 6:117911434-117911456 CAGAAGGATGGAAGGAAGGAAGG - Intronic
1014230590 6:118897801-118897823 CAGAGGAATTAAATGAAAGCTGG + Intronic
1014312231 6:119818428-119818450 CAGATAAAAGAAAAGAAGGGTGG + Intergenic
1014453745 6:121613321-121613343 CAGTAGAATGAAAAGAAGGGTGG + Intergenic
1014599238 6:123388521-123388543 AAGAAGGATGAAAAGAAGGAAGG - Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015001000 6:128215583-128215605 CAGAAGAATAAAAAAAAGTATGG - Intronic
1015027898 6:128559013-128559035 AACAAGAATGAGCAGAAGGCTGG - Intergenic
1015208135 6:130665407-130665429 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1015233078 6:130938901-130938923 CAGAGGAAGAAAAAGTAGGCAGG + Intronic
1015387955 6:132647678-132647700 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015481834 6:133720426-133720448 GAGATGAATGCAGAGAAGGCAGG - Intergenic
1015548601 6:134388468-134388490 AAAAAGAAAGAAAAGAAGGAAGG - Intergenic
1015561809 6:134524285-134524307 CAGAAAATTGAAGAGAAGGAGGG + Intergenic
1015827682 6:137332217-137332239 CCCAAGAATGAAAAGTATGCAGG + Intergenic
1016083775 6:139887155-139887177 CAGAAGAAGGAAAAGAGAGAGGG + Intergenic
1016318723 6:142818982-142819004 CAGAAGAAAGGAAAGGAGGGAGG + Intronic
1016439997 6:144073718-144073740 CAGGAGAGTGAAAGGAAGGCAGG - Intergenic
1016554108 6:145316051-145316073 AAAAAGAAAGAAAAGAAGTCAGG + Intergenic
1016732071 6:147437802-147437824 GAAAAGAATGGAAAGCAGGCCGG + Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017328577 6:153169768-153169790 AAGAAGGATTGAAAGAAGGCTGG + Intergenic
1017619242 6:156278336-156278358 AAGAAGAGTGAAAAGAGGGAGGG + Intergenic
1017678406 6:156839040-156839062 AAGTAGGAAGAAAAGAAGGCAGG - Intronic
1017726480 6:157279598-157279620 GAGAAAAAAGAAAAGAAGGAGGG + Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018234468 6:161710780-161710802 AGGAAGAAAGAAAAGAAGGAAGG - Intronic
1018320392 6:162602250-162602272 GAGAAGAGAGAAGAGAAGGCAGG + Intronic
1018435767 6:163757564-163757586 GAGCAGCCTGAAAAGAAGGCAGG - Intergenic
1018693562 6:166370555-166370577 AAGAAAACTAAAAAGAAGGCCGG + Intronic
1018934661 6:168265838-168265860 CAGGACAATGGAAAGAAGGGTGG - Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019041080 6:169106737-169106759 CAGAAGAAAGAAAAGAGGGGAGG - Intergenic
1019203833 6:170342481-170342503 CAGAAGAGTGAAAGGCATGCTGG - Intronic
1019254405 7:40051-40073 CAGAAGAATGGACAGAGGGATGG - Intergenic
1019697281 7:2452634-2452656 AAGAAGAAGGAAAAGAAAGAAGG - Intergenic
1020314453 7:6895119-6895141 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1020417891 7:7967719-7967741 CACAAGGAAGAAAAGAAGGATGG + Intronic
1020705473 7:11538538-11538560 CAGAAAAATTAAAATAGGGCGGG + Intronic
1020821333 7:12971864-12971886 CAGAAGAGTGAAAAGTACCCAGG - Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1020950122 7:14664900-14664922 AAGAAGGAAGGAAAGAAGGCAGG + Intronic
1021352055 7:19605880-19605902 GAGAAAAATGAAAAGAAGGAGGG - Intergenic
1021473137 7:21029293-21029315 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1021558774 7:21947579-21947601 CAGAAAAATGGAAAGAATGTTGG - Intergenic
1021792214 7:24217186-24217208 CACATGAAGGAAAAGAAAGCTGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022073486 7:26941475-26941497 CAGAAGGATGGAAGGAAGGAAGG + Intronic
1022420459 7:30216160-30216182 GAGAGGAAAGAAAAGAAGGAAGG + Intergenic
1022730274 7:33016373-33016395 CAAAAAAAAAAAAAGAAGGCCGG + Intronic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1023175457 7:37431588-37431610 AACTAGAATGAAAGGAAGGCTGG + Intronic
1023314400 7:38920471-38920493 CAGATAAGTGAAAAGAAGGATGG + Intronic
1023533337 7:41182252-41182274 AAAAAGAAAGAAAAGAAGGAAGG - Intergenic
1023559401 7:41458149-41458171 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1023660900 7:42469895-42469917 CTGGAGAATGAAAACAAGGCAGG + Intergenic
1023897323 7:44444834-44444856 CAGCAGCCTGAACAGAAGGCTGG - Intronic
1024451085 7:49543667-49543689 CAGATGAAGGAAAACAAAGCGGG + Intergenic
1024619456 7:51145310-51145332 CAAAAGAATTAAAAACAGGCCGG - Intronic
1024914997 7:54488946-54488968 AAGAAGGAAGAAAGGAAGGCAGG - Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025245002 7:57310277-57310299 CAGATGGATGAAAGGAAGGATGG - Intergenic
1025307478 7:57875993-57876015 CAGAAGAATGGCATGAAGCCAGG - Intergenic
1025488151 7:61077504-61077526 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1025623767 7:63199273-63199295 CAGAGGAGTTAACAGAAGGCAGG - Intergenic
1025773423 7:64535373-64535395 CAAAAGAAAGAAAAGAAGGAAGG + Intronic
1025838213 7:65116435-65116457 CAGAAGAATGGCATGAAGCCGGG + Intergenic
1025879060 7:65516649-65516671 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1025884858 7:65579539-65579561 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1025917761 7:65879716-65879738 AAAAAGAAAGAAAAGAAGGAAGG - Intronic
1025988890 7:66479749-66479771 AATAAGAATGAGCAGAAGGCTGG - Intergenic
1026103728 7:67404031-67404053 AAGATGAATGAAAAGTAGGAAGG - Intergenic
1026110551 7:67455794-67455816 GAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1026258585 7:68734420-68734442 AAGAAGTAGGACAAGAAGGCCGG - Intergenic
1026689573 7:72540244-72540266 AAGAGGAAGAAAAAGAAGGCAGG + Intergenic
1026966444 7:74443206-74443228 CAGAAGAATGGCAAGAACCCGGG - Intergenic
1027454204 7:78367396-78367418 CGGAAGAATTAAAATAGGGCAGG + Intronic
1027676486 7:81164681-81164703 CAGAAGAAAGAACAGAACACAGG + Intergenic
1027689352 7:81322754-81322776 AAGAAGATAGAAAAGAAGGAGGG - Intergenic
1027975039 7:85142650-85142672 TAGAAGAAAGCAAAGAAGGATGG + Intronic
1028047866 7:86146100-86146122 CATAAGAATAAAAAGAAAGAAGG + Intergenic
1028451899 7:90994488-90994510 CATAAGAATGTCAAGAACGCTGG + Intronic
1028712883 7:93930217-93930239 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1028759178 7:94475967-94475989 GAGAAGAAAGAAAAGAAGGAGGG - Intergenic
1028904727 7:96140252-96140274 CAAAAGAATGGAAATCAGGCCGG - Intronic
1029035431 7:97515277-97515299 CACAGGAATGAAAAGAAGCAAGG - Intergenic
1029145010 7:98439609-98439631 GAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1029575811 7:101402593-101402615 GAGAAGAAAGGAAAGAAGGAAGG - Intronic
1029636124 7:101785363-101785385 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1030194617 7:106841424-106841446 CAGATGAATGGATAGATGGCAGG + Intergenic
1030249236 7:107423898-107423920 AAAAATAATGAAAAGAATGCAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030454061 7:109750251-109750273 CACAAGTATGAAAAAAGGGCAGG + Intergenic
1030605118 7:111632529-111632551 AAGAAAAAAGAAAAGAAGGAAGG - Intergenic
1030662858 7:112240175-112240197 TAGAAGAAAGGAAAGAAGGAAGG + Intronic
1031100424 7:117472999-117473021 TAGAGGAATGAAAAGTATGCAGG - Intronic
1031405088 7:121375723-121375745 AAGAAGATTGAAGAGAAGGCTGG - Intronic
1031507144 7:122599056-122599078 GTGCAGAATGAAAGGAAGGCAGG + Intronic
1031729780 7:125285060-125285082 GAAAGGAAGGAAAAGAAGGCAGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032270152 7:130397866-130397888 CATGAGAATGAAAAGTAAGCAGG + Exonic
1032277283 7:130469501-130469523 CAAAAGAAAGAAAAAAAGACAGG - Intergenic
1032337092 7:131035292-131035314 GAAAAGAAGGAAAAGAAGGAAGG + Intergenic
1032337106 7:131035391-131035413 GAAAAGAAAGAAAAGAAGGAAGG + Intergenic
1032576168 7:133057332-133057354 CAGAAGGATGGAATGAAGCCAGG + Intronic
1033120375 7:138662788-138662810 CAGAAGGATTAAAGGAAGGAAGG - Intronic
1033248191 7:139736288-139736310 CAGGAGAATGAAGGGAAGGCTGG + Intronic
1033524177 7:142194013-142194035 AAGAAGAAAGAAAAGACTGCAGG - Intronic
1033650653 7:143340507-143340529 GAGAAGAGAGAAAAGAAGGAAGG - Intronic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1034251418 7:149693673-149693695 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1034733442 7:153408195-153408217 AAGATGAATCAAAAGAAAGCTGG - Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1036175188 8:6531048-6531070 CAGAAGCATGTAAAGAAGCCAGG + Intronic
1036182020 8:6593947-6593969 CAGAAGCATGGATAGAAGGCTGG + Intronic
1036508453 8:9378399-9378421 AAGTAGAAAGAAAAGAAGGAAGG + Intergenic
1036511328 8:9403089-9403111 CACAAAAAAGAAAAGCAGGCAGG + Intergenic
1036576581 8:10033011-10033033 AAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1036708436 8:11061768-11061790 CCAAAGAATGAGAAGAAGGAAGG + Intronic
1036797515 8:11766981-11767003 GAGAAGGAAGAAAAGAAGGAAGG + Intergenic
1037189852 8:16110978-16111000 CAGAAGAAGGAAAAGAAAAAAGG + Intronic
1037383887 8:18317289-18317311 CTGAAGAATAAACAGAAAGCAGG - Intergenic
1037481187 8:19307443-19307465 CAGAAGGATAAAAAGAATGGAGG - Intergenic
1037785969 8:21903469-21903491 CAAAAAAATAAAAAGCAGGCCGG + Intergenic
1037914588 8:22765140-22765162 CAGAAGAAAGAAAGGAAGGAAGG - Intronic
1038252110 8:25914518-25914540 CACAAGAATGAAAAGACTCCAGG + Intronic
1038616876 8:29103702-29103724 TAGAGGAATGGAAAGCAGGCTGG + Intronic
1038654033 8:29432168-29432190 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1038792273 8:30678686-30678708 AAGAAAAAAGAAAATAAGGCAGG + Exonic
1038839218 8:31164132-31164154 CAAAAGAAATAAAAGAGGGCTGG - Intronic
1038955333 8:32462154-32462176 CAGAAGAACAAAGAGAAGGTTGG + Intronic
1039142741 8:34411146-34411168 AGGAAGAAGGAAAAGAAGGAAGG + Intergenic
1039189696 8:34958999-34959021 CAGAAGAATGACATGAACCCAGG - Intergenic
1039197491 8:35048598-35048620 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1039257591 8:35735888-35735910 CAAAAGAGTAAAAAGAAAGCAGG + Intronic
1039457194 8:37715381-37715403 GAAAAGAAGGAAAAGAAGGAAGG + Intergenic
1040450865 8:47545363-47545385 AAAAAGAAAGAAAAAAAGGCCGG - Intronic
1040491058 8:47922604-47922626 CTTAAAAATGAAAAGCAGGCTGG - Intronic
1040837134 8:51744369-51744391 GAGAAAAAAGAAAGGAAGGCTGG + Intronic
1040875393 8:52146353-52146375 GAGAAGAATGAAGAAATGGCAGG - Intronic
1041155747 8:54985245-54985267 CAGAAGGAAGAAAGGAAGGAAGG + Intergenic
1041260615 8:56018123-56018145 TAGAAAAATAAAAATAAGGCCGG - Intergenic
1041624101 8:60005470-60005492 GAAAAGAAAGAAAAGAAGGAAGG + Intergenic
1041751492 8:61265797-61265819 CATAAGATGGGAAAGAAGGCAGG - Intronic
1041791972 8:61706502-61706524 AAGAAGAAAGAAGAGAAAGCAGG + Intronic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041865980 8:62573529-62573551 AAAAAGGAAGAAAAGAAGGCAGG - Intronic
1041902634 8:62998568-62998590 TAGAAAAATGAAAAGCAGCCAGG - Intronic
1042039088 8:64573475-64573497 AGGAAGGATGAAAGGAAGGCAGG - Intergenic
1042135232 8:65626722-65626744 TAAAAGAATAAAAACAAGGCTGG + Intronic
1042220255 8:66466521-66466543 AAAAGGAATGAAAAGAAGGATGG - Intronic
1042732229 8:71948775-71948797 AGAAAGAATGAAAAGAAGGAAGG + Intronic
1042762936 8:72290496-72290518 CAGAAGTATGAAAAGAGAGATGG - Intergenic
1042808015 8:72792890-72792912 CAGAAGGATAAAAAGAATTCCGG - Intronic
1043450501 8:80361428-80361450 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1043548916 8:81346479-81346501 CCGAAGAATGAAGAGAAGACTGG + Intergenic
1043590188 8:81822412-81822434 CCTAAGATTGAAAAGAAGGCAGG + Intronic
1043762160 8:84081592-84081614 CAAATGAATGAAATGAAGCCAGG - Intergenic
1043834119 8:85027001-85027023 AAGAAGAAAGAAAGAAAGGCTGG + Intergenic
1043998381 8:86847427-86847449 CATAAGAAAGAAAGGAAGGAAGG + Intergenic
1044014394 8:87032888-87032910 CAGAAGAATTAACAGAAGATGGG - Intronic
1044041070 8:87368923-87368945 CATGAGAAGGAAAAGAAGGAGGG - Intronic
1044205606 8:89489407-89489429 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1044953263 8:97453958-97453980 CAGCAGACAGCAAAGAAGGCTGG - Intergenic
1045023142 8:98061826-98061848 GAGAAGAAAAAAAAGAAGGAAGG + Intergenic
1045330402 8:101151159-101151181 CTGAAGAATGAGAACAAGCCAGG - Intergenic
1045543925 8:103111538-103111560 CTGAAGAAAGATCAGAAGGCTGG + Intergenic
1046517192 8:115277854-115277876 AAGAAGAAAGAAAAGAAAGAAGG + Intergenic
1046608763 8:116401248-116401270 TATAAGAATAAAAAGAAAGCTGG - Intergenic
1046734294 8:117759908-117759930 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1046916877 8:119687628-119687650 CAAAAGAATAAAGAGAAGGTCGG - Intergenic
1047323989 8:123819047-123819069 CAGAAGATTTAAAAGAAAACTGG + Intergenic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047472666 8:125193736-125193758 CAGAAGAATTGAAAGAAGAAAGG + Intronic
1047549037 8:125849985-125850007 AAGAAGGAAGGAAAGAAGGCAGG - Intergenic
1047873433 8:129109952-129109974 CAGAAGAATGAAAATGAGAGGGG - Intergenic
1047915163 8:129575173-129575195 AAGAAGAAAGGAAAGAAGGGAGG + Intergenic
1047945108 8:129869087-129869109 AAGAAGAAAGAAAAAAAGGCTGG + Intronic
1048210891 8:132453374-132453396 CAGAAGACAGAAGAGAAGTCAGG + Intronic
1048250942 8:132866457-132866479 TAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1048366366 8:133742334-133742356 TAGAAGAATGGAAAGAAGGAAGG + Intergenic
1048522163 8:135166447-135166469 GAGAAAAATGAAAGGAAGGAAGG - Intergenic
1048870748 8:138795317-138795339 CACAAGAATGAAAAGCAGTTTGG - Intronic
1048876558 8:138841034-138841056 AAGAAGAATGGAAGGAAGGAAGG - Intronic
1050161504 9:2724451-2724473 AAGAAGAAAAAAAAGAAGACTGG + Intronic
1050206736 9:3204446-3204468 CAGGAGAAAAGAAAGAAGGCCGG - Intergenic
1050247486 9:3705944-3705966 CAGGAGAATGACAAGAACCCGGG + Intergenic
1050414121 9:5397515-5397537 AAGAAGGAAGAAAAGAGGGCAGG + Intronic
1050875687 9:10632726-10632748 CAAAAGAATGAATAAAATGCTGG + Intergenic
1050943449 9:11488598-11488620 CAAAAGAGTGAAAATAAGGGAGG - Intergenic
1051345370 9:16146430-16146452 CAGAAGGAAGAAAGGAAGGGAGG - Intergenic
1051543461 9:18247761-18247783 CAGAAGAAGGAAAGGAGGGAGGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051644803 9:19257192-19257214 GAACAGAATAAAAAGAAGGCCGG + Intronic
1051648861 9:19299925-19299947 CAGAAGAATGGAGACAAGGATGG - Intronic
1051858838 9:21601041-21601063 CAAAGGAAGGACAAGAAGGCTGG + Intergenic
1051872027 9:21749136-21749158 GAAATGAAAGAAAAGAAGGCAGG + Intergenic
1051891893 9:21950755-21950777 AAGAAGAAAGAAAAGAAAACTGG + Intronic
1051905295 9:22088031-22088053 CAGAAGAACTAAAAGAAAGGAGG + Intergenic
1051945338 9:22562927-22562949 CAGAAGAATGGCATGAACGCGGG - Intergenic
1052029371 9:23610968-23610990 TTGAAGAATGAAAGGAAGGAAGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052196768 9:25726600-25726622 CAGAAGAATGAAAGGAAAATTGG - Intergenic
1052430650 9:28362411-28362433 CAGAAGAATCAAAAGAAAAGAGG + Intronic
1052532779 9:29708934-29708956 CAGAAGAAAGGAGAGAAGGAAGG + Intergenic
1052909786 9:33870139-33870161 CAAAAAAATAAAAATAAGGCTGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053140429 9:35679412-35679434 GAGAAGAAAGAAATCAAGGCTGG + Intronic
1053148220 9:35726392-35726414 GGCAAAAATGAAAAGAAGGCAGG - Intronic
1053247939 9:36550519-36550541 CAGAAAAATGAAAATTAGCCAGG + Intergenic
1053346239 9:37380375-37380397 CAAAAGTATGAAAAATAGGCTGG + Intergenic
1053516528 9:38735071-38735093 CAGAAGGAAGAAAAGAAGGAAGG - Intergenic
1053685902 9:40522150-40522172 GAGAAGAAAGAAAAGAACGACGG + Intergenic
1053711316 9:40812204-40812226 GAGAAGAAAGAAAAGAAGGACGG + Intergenic
1053935852 9:43150444-43150466 GAGAAGAAAGAAAAGAAGGACGG + Intergenic
1054277833 9:63102816-63102838 GAGAAGAAAGAAAAGAACGACGG - Intergenic
1054298983 9:63357609-63357631 GAGAAGAAAGAAAAGAACGACGG + Intergenic
1054397004 9:64662111-64662133 GAGAAGAAAGAAAAGAACGACGG + Intergenic
1054421226 9:64933021-64933043 GAGAAGAAAGAAAAGAAGGACGG + Intergenic
1054431646 9:65167315-65167337 GAGAAGAAAGAAAAGAACGACGG + Intergenic
1054498732 9:65854204-65854226 GAGAAGAAAGAAAAGAACGACGG - Intergenic
1054604419 9:67160904-67160926 CAGGAGAATGACATGAAGCCGGG - Intergenic
1055072127 9:72177189-72177211 CAGAAGAATGAAGTGAACCCGGG - Intronic
1055081476 9:72271467-72271489 AAGAAGAAAGAAAAGAAAGAAGG + Intergenic
1055706337 9:79008908-79008930 AAGAAGAAAGGAAAGAAGGCAGG + Intergenic
1055896960 9:81188233-81188255 CAGTGAAATGAAAAGAAAGCGGG - Intergenic
1055946496 9:81695801-81695823 TAAAAAAATAAAAAGAAGGCCGG - Intergenic
1055966416 9:81869314-81869336 CAAAAAAAAGAAAAGAAGGAAGG - Intergenic
1056016810 9:82397776-82397798 GAGAAGAAAGAAAACAAGGTTGG - Intergenic
1056444164 9:86648604-86648626 CAGAAGAAAGGAAGGAAGGGAGG - Intergenic
1056473457 9:86928800-86928822 CAGAAGAATGAAATGAGGTTGGG + Intergenic
1056645642 9:88409289-88409311 AAGAAAAAAGAAAAGCAGGCCGG - Intronic
1057000271 9:91502793-91502815 AAGAAGTATGAGAAGAACGCAGG - Intergenic
1057201214 9:93141156-93141178 CAAAAAAATAAAAAGAAGGTGGG + Intergenic
1057273184 9:93662156-93662178 CAGAGGAATGAATAGATGGATGG + Intronic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1057742013 9:97720187-97720209 AGAAAGAAAGAAAAGAAGGCCGG + Intergenic
1057859368 9:98627437-98627459 CGGAAGAATGAACAAGAGGCTGG - Intronic
1057962231 9:99467849-99467871 AAGAAGAATAAAAAGAAGAGGGG + Intergenic
1057985661 9:99711287-99711309 CAGCAGAAAGAAAAGTATGCTGG - Intergenic
1058596495 9:106621281-106621303 GGGAAGAAAGAAAAGAAGGGGGG + Intergenic
1058873356 9:109221249-109221271 AGGAAGAATGAAAGGAAGGATGG + Intronic
1058927666 9:109683466-109683488 CAGAAGCAGGGAGAGAAGGCAGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059266583 9:113038032-113038054 CTGAAGAATGAACAAAAAGCAGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1059795686 9:117694060-117694082 AGGAAGAATGAAAGGAAGGAAGG - Intergenic
1059918248 9:119128250-119128272 CAAAAGTTTGAAAAGAAGGAAGG - Intergenic
1060045494 9:120337026-120337048 TGGAAGAAAGAAAAGAAGGACGG + Intergenic
1060124813 9:121033433-121033455 CATAACAATGAAAAGAAGCCAGG + Intronic
1060180405 9:121529789-121529811 CAGGAGAGTGAGAAGAAAGCTGG + Intergenic
1060257467 9:122045254-122045276 CAAAAGAATTGAAAGCAGGCTGG + Intronic
1060592737 9:124829158-124829180 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1060752373 9:126181767-126181789 CTGAACAATGGAAAGAAGGCTGG - Intergenic
1061122965 9:128655611-128655633 AAAAAGAAAAAAAAGAAGGCCGG + Intronic
1061211611 9:129196835-129196857 CAAAAGAAAGGAAAGAAGGAAGG - Intergenic
1061244697 9:129395449-129395471 AAGATGAATGGAAAGAAGGATGG + Intergenic
1061421305 9:130474175-130474197 AAGGAGAGTAAAAAGAAGGCAGG + Intronic
1061560432 9:131398977-131398999 CAAAAGAATAAAAAGTAGGTCGG + Intronic
1061934959 9:133852361-133852383 CAGAAGAATAAAAAGAAGGAAGG + Intronic
1061979031 9:134089314-134089336 AAGAAGAAGGGAAAGATGGCTGG + Intergenic
1062010842 9:134265833-134265855 CAGAAGGAAGAAATGAAGGTAGG - Intergenic
1062143372 9:134972779-134972801 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1062143942 9:134978725-134978747 AGGAAGAAAGAAAGGAAGGCAGG + Intergenic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062679310 9:137768981-137769003 CAAAAGAATGCAGAAAAGGCTGG - Intronic
1062719632 9:138031821-138031843 CATATTAATCAAAAGAAGGCAGG - Intronic
1062745995 9:138212490-138212512 CAGAAGAATGGACAGAGGGATGG + Intergenic
1062755593 9:138285467-138285489 TAAAAGAGAGAAAAGAAGGCTGG - Intergenic
1185501725 X:601937-601959 AAGAAGAATGGAAGGAAGGAAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185545020 X:936550-936572 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1185674082 X:1834632-1834654 AAAAAGAAAGAAAAGAAGGAAGG + Intergenic
1185834036 X:3328840-3328862 CAGAAGGAAGAAAGGAAGGCAGG + Intronic
1185843680 X:3417125-3417147 AGGAAGAAAGAAAAGAAGGAAGG - Intergenic
1185908995 X:3965332-3965354 CATTAGAATGAAAGGAATGCAGG - Intergenic
1186128513 X:6441863-6441885 AAAAAGAAAGAAAAGAAGGGAGG + Intergenic
1186560739 X:10610012-10610034 TAGAAAAACAAAAAGAAGGCCGG - Intronic
1186671580 X:11772271-11772293 ATGAAAAATGGAAAGAAGGCAGG - Intronic
1186749466 X:12606781-12606803 CAGAAAGAAGAAAAGAAGGGAGG - Intronic
1186891153 X:13960469-13960491 CACAAGAATGAAATGAATGCAGG + Intergenic
1186901199 X:14058621-14058643 CCAAAGACTGGAAAGAAGGCAGG + Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1187942629 X:24396814-24396836 TACAAAAATGAAAAGAAGACTGG - Intergenic
1187957682 X:24535912-24535934 AAAAAGAAAGAAAAGAAGGAAGG + Intronic
1188009024 X:25038713-25038735 ATGAAGAATGGAAAGAAGGATGG + Intergenic
1188032094 X:25275556-25275578 CAGAGGAATGGACACAAGGCAGG - Intergenic
1188142836 X:26573700-26573722 AAGGAGAATGAAAAGAAGGAAGG - Intergenic
1188310857 X:28614979-28615001 CAGAAGAATGGAGTGAAGCCGGG - Intronic
1188574855 X:31635509-31635531 CAGAAGACAGCAAAGCAGGCAGG + Intronic
1189121317 X:38398146-38398168 AAGAAGACTGAAAAAAAGGCAGG - Intronic
1189244467 X:39552776-39552798 CAGCACAATAAAATGAAGGCAGG - Intergenic
1189468015 X:41292429-41292451 CAGAAAATAGAAAAGAGGGCTGG + Intergenic
1189542004 X:42001676-42001698 CAAAAAAATTAAAAGAAAGCTGG - Intergenic
1189588692 X:42488823-42488845 CAAATGAAGGAAAAGATGGCTGG - Intergenic
1189666615 X:43361967-43361989 CAGTAGACTGCAAAGAAGGGAGG + Intergenic
1189729147 X:44000696-44000718 CAGGAGAATGGAATGAACGCAGG - Intergenic
1189774132 X:44455134-44455156 AAGAAGAAAAAAAAAAAGGCTGG - Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1189834004 X:45002865-45002887 GAGAAGAATGAAAAGGGGGGGGG - Intronic
1189984098 X:46538593-46538615 AAAAAAAATGAAAAGAAGACTGG + Intronic
1190165561 X:48070672-48070694 CAGAAAAATGAACAAAAGACAGG + Intronic
1190748418 X:53340713-53340735 CACAAAAATGAGAAAAAGGCTGG + Intergenic
1190834975 X:54092245-54092267 GAAAAAAATGAAAAGAAGGCTGG + Intronic
1190871102 X:54425368-54425390 CACAAGATTAAAAGGAAGGCTGG + Intergenic
1190999557 X:55645983-55646005 ATGAAGAATGAAACCAAGGCTGG - Intergenic
1191857166 X:65636438-65636460 TAGAGAAATGAAAAGCAGGCTGG + Intronic
1191886655 X:65895375-65895397 TAGATGAATGAAAAGAAGAAAGG + Intergenic
1192552317 X:72064355-72064377 CAGCAGAATGAAAAGGAGACAGG + Intergenic
1192785807 X:74334437-74334459 CAGAAGAATGACATGAACGCAGG - Intergenic
1192833826 X:74778428-74778450 AAGAAAAAAGAAAAGAAGGAAGG - Intronic
1193119406 X:77807682-77807704 AAGAAGAAAGAAAGAAAGGCAGG - Intergenic
1194357257 X:92901233-92901255 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194423732 X:93710122-93710144 AAGAAGAAGAAAAAGAAGTCTGG + Exonic
1194440361 X:93925389-93925411 CAGAAGAAAGGAAGGAAGGATGG + Intergenic
1194543520 X:95204436-95204458 AAGAATAATGAAAAGAAAGCAGG - Intergenic
1195106133 X:101603143-101603165 CATAAAAATAAAATGAAGGCAGG - Intergenic
1196185678 X:112742606-112742628 CAGATGAAGTAACAGAAGGCAGG + Intergenic
1196235903 X:113279281-113279303 CAGAATAAAGAAAGGAAGGAAGG + Intergenic
1196653293 X:118190493-118190515 AAGAAGAAAGAAAAGAAAGAAGG + Intergenic
1196789261 X:119449431-119449453 AAGAAGAATGAATTGGAGGCTGG + Intronic
1196904137 X:120415674-120415696 AAGAAGAAAGAAAGGAAGGGAGG - Intergenic
1197038725 X:121908603-121908625 CATCAAAATGAAAAAAAGGCAGG - Intergenic
1197128885 X:122980626-122980648 CAGAAGATGAAAAAGAAGACAGG + Intergenic
1197345657 X:125323861-125323883 AAGAAGAGTGAAAGGAAGTCAGG + Intergenic
1197371743 X:125635425-125635447 AAGAAGAATGAAAAAAATGCAGG + Intergenic
1197409644 X:126099369-126099391 CAGAAAAATGAAAAAAAGATGGG - Intergenic
1197686426 X:129444062-129444084 CCTTAGAATCAAAAGAAGGCAGG - Intergenic
1197923106 X:131616916-131616938 CAGCAGCATTAAAAGAAGCCAGG - Intergenic
1198041740 X:132859695-132859717 AAGAATGAAGAAAAGAAGGCAGG + Intronic
1198169375 X:134090760-134090782 CACAAGTTTGAAAAGAAGGGAGG + Intergenic
1199264184 X:145811014-145811036 TAAAAGAAAGAAAAGAAGGAAGG + Intergenic
1199312769 X:146340924-146340946 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1199464031 X:148116063-148116085 CTGAAGAAAGAAAGGAAGGAAGG + Intergenic
1199510490 X:148616311-148616333 CATAAAAATGAAAAGAACCCAGG + Intronic
1199680522 X:150221392-150221414 TGGAAGAGTGAAAAGGAGGCTGG - Intergenic
1199804637 X:151286005-151286027 GAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1200473514 Y:3617442-3617464 AAGCACAATGAAAAAAAGGCAGG - Intergenic
1200665587 Y:6018229-6018251 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1200872264 Y:8114845-8114867 CAGAAGAAAAGAAAGAAGGAAGG + Intergenic
1201316903 Y:12656295-12656317 CAAAAACATGAAAAGAAGGCAGG - Intergenic
1201317223 Y:12659536-12659558 CAGAAGAGTTAACGGAAGGCGGG + Intergenic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201536844 Y:15058590-15058612 AAGAAGAAAAAAAAAAAGGCCGG - Intergenic
1201550559 Y:15212695-15212717 AAGAAGAAAGAAAGGAAGGAAGG + Intergenic
1201733217 Y:17228413-17228435 CAAAAAAAAGAAAAAAAGGCCGG - Intergenic
1201733715 Y:17234530-17234552 AAGAAGAAAGAAAGGAAGGAAGG - Intergenic
1201788519 Y:17810998-17811020 AGGAAGAAAGAAAAGAAGGAAGG - Intergenic
1201813034 Y:18094990-18095012 AGGAAGAAAGAAAAGAAGGAAGG + Intergenic
1201927406 Y:19302811-19302833 AAGAAGAAGGAAAAGAAGCAAGG - Intergenic
1202332838 Y:23772692-23772714 AAAAAGAAAGAAAAGAAGGAAGG - Intergenic
1202376745 Y:24245487-24245509 CAGAAGCCTGAAAGGAAAGCGGG + Intergenic
1202494035 Y:25424634-25424656 CAGAAGCCTGAAAGGAAAGCGGG - Intergenic
1202537931 Y:25897371-25897393 AAAAAGAAAGAAAAGAAGGAAGG + Intergenic