ID: 955913853

View in Genome Browser
Species Human (GRCh38)
Location 3:63886147-63886169
Sequence CACAGAAAGACAAATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 7, 1: 24, 2: 82, 3: 166, 4: 579}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955913851_955913853 7 Left 955913851 3:63886117-63886139 CCTGGAGGATATTAAGTGAAATA 0: 2
1: 29
2: 55
3: 106
4: 479
Right 955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG 0: 7
1: 24
2: 82
3: 166
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955913853 Original CRISPR CACAGAAAGACAAATACTGC AGG Intronic
900676900 1:3892696-3892718 CAGAGAAAGACACACTCTGCAGG - Intronic
901502199 1:9659619-9659641 AATAAAAAGACAAATACTGTAGG - Intronic
903918742 1:26784354-26784376 CACTGAAAGGCAAACACTGAAGG + Intergenic
904540441 1:31229247-31229269 TACAGAAAGACTAATACTCTTGG - Intronic
905982570 1:42243117-42243139 CCCAGAAATACAAAAACTGAAGG + Intronic
906065513 1:42977770-42977792 AACAGAAAAGCAAACACTGCAGG - Intergenic
906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG + Intronic
908269427 1:62408757-62408779 TTCACAAAGACAAATAATGCAGG + Intergenic
908430865 1:64055925-64055947 CACAAAAGGACAAATATTGTCGG - Intronic
909101418 1:71354007-71354029 AACAGAAAGCCAAATACCACAGG + Intergenic
909155762 1:72073910-72073932 CACAGAATGACAAATGATACTGG + Intronic
909852382 1:80484334-80484356 AACAGAAAATCAAATATTGCAGG + Intergenic
910511279 1:88008021-88008043 CACAGAATACCAAATACTTCTGG - Intergenic
911119288 1:94279218-94279240 CACAGAAATACTAATGCTGCTGG - Intergenic
911255562 1:95629191-95629213 CACAGAAAGACAAATATCACAGG - Intergenic
911313362 1:96325164-96325186 TACAGAAAGACAAATACTGCAGG + Intergenic
911379012 1:97088941-97088963 AACAGAAAGAAAAATAGTGGAGG - Intronic
911908941 1:103606835-103606857 CAGAGAATGAAAAATACTACAGG + Intergenic
911911257 1:103639131-103639153 CAGAGAAAGAAAAATACTACAGG + Intergenic
911913978 1:103672626-103672648 CAGAGAATGAAAAATACTACAGG - Intronic
911917197 1:103712819-103712841 CAGAGAAAGAAAAATACTACAGG - Intronic
911918672 1:103733269-103733291 CAGAGAAAGAAAAATACTACAGG + Intronic
911921787 1:103772317-103772339 CAGAGAAAGAAAAATACTACAGG + Intergenic
913470869 1:119184352-119184374 CACACAAAGACAAATACCATAGG - Intergenic
913648676 1:120888065-120888087 CTCAGAAAGACAAACACTGAAGG + Intergenic
914078019 1:144375298-144375320 CTCGGAAAGACAAAGACTGAAGG - Intergenic
914101160 1:144591203-144591225 CTCGGAAAGACAAAGACTGAAGG + Intergenic
914172928 1:145243833-145243855 CTCGGAAAGACAAAGACTGAAGG - Intergenic
914297816 1:146346443-146346465 CTCGGAAAGACAAAGACTGAAGG - Intergenic
914527581 1:148484969-148484991 CTCAGAAAGACAAAGACTGAAGG - Intergenic
914638812 1:149582093-149582115 CTCGGAAAGACAAAGACTGAAGG + Intergenic
914906275 1:151748160-151748182 CACAGAAAGAAAAATCCTCCAGG - Intergenic
916106811 1:161439128-161439150 CACAGAAAGACAGAGAGGGCAGG + Intergenic
916108251 1:161446180-161446202 CACAGAAAGACAGAGAGGGCAGG + Intergenic
916109837 1:161453560-161453582 CACAGAAAGACAGAGAGGGCAGG + Intergenic
916111424 1:161460971-161460993 CACAGAAAGACAGAGAGGGCAGG + Intergenic
916113010 1:161468351-161468373 CACAGAAAGACAGAGAGGGCAGG + Intergenic
916277544 1:163011389-163011411 CACAGAAAGACAAATATTATAGG - Intergenic
916554913 1:165886136-165886158 CACAAAAAGACAAATACCATAGG - Intronic
916575319 1:166061802-166061824 CACAGAATGACAGACACAGCAGG + Intronic
916716914 1:167454626-167454648 CACAGAAAACCAACTACTGCTGG + Intronic
916919450 1:169448384-169448406 CTCAGAAAAACAAAAACTGAAGG - Intronic
916927468 1:169538230-169538252 CACAGAAAGACAAGTACTGCAGG + Intronic
917055327 1:170975631-170975653 AACAGAAAGTCAAATACCACAGG - Intronic
917393944 1:174571166-174571188 CACAGAAAGACAAACATCACAGG + Intronic
918027762 1:180769527-180769549 CACAGAAACACAAACATTGCAGG - Intronic
918096252 1:181336814-181336836 CACAAAAGCACAAATACTGTAGG - Intergenic
918155615 1:181843292-181843314 AACAGAAAGTCAAACACCGCAGG - Intergenic
918788536 1:188796173-188796195 AACAGAAAACCAAACACTGCAGG - Intergenic
918944393 1:191043150-191043172 CACCGAAAGACAAATACTGTAGG + Intergenic
918979287 1:191534204-191534226 CACAGAAAGAAAAAAAGGGCAGG + Intergenic
919067002 1:192704901-192704923 CACAGAAAGACAAATGTTACAGG - Intergenic
919218105 1:194587366-194587388 CGCAGAAGGACAAAGATTGCAGG - Intergenic
920134089 1:203755522-203755544 CACAGAAATACAAAAGCTACTGG + Intergenic
920698564 1:208200445-208200467 ACCAGAACGACAAATACTTCAGG - Intronic
921109708 1:212022995-212023017 AACAGAAAACCAAATACTGTAGG - Intronic
921724184 1:218506338-218506360 AACAGAAAATCAAATACTGCAGG - Intergenic
921838067 1:219798749-219798771 CACATAAAGATAAATTCTTCAGG + Intronic
922250842 1:223846892-223846914 TCCAGAGAGACACATACTGCGGG + Intergenic
922527822 1:226319346-226319368 CACATAAGGAGAAATACTGTAGG + Intergenic
922971291 1:229742251-229742273 AACAGAAAATCAAATACAGCAGG - Intergenic
923642846 1:235783007-235783029 CACAGAAAGACACACAAAGCAGG + Intronic
924320643 1:242845240-242845262 AACAGAAAAACAAATACTGTAGG - Intergenic
924702305 1:246466425-246466447 AAAAGAAAACCAAATACTGCAGG + Intronic
924833336 1:247621790-247621812 CACAGAGAGACAAATACCACAGG - Intergenic
1062790331 10:300388-300410 CACGAAAAGACAAATACCACAGG + Intronic
1063215555 10:3922505-3922527 CATATAAAAACAAAAACTGCAGG - Intergenic
1063356922 10:5409862-5409884 CACAAAATGATAGATACTGCAGG - Intergenic
1063499798 10:6543172-6543194 CACAGAAATACAGGAACTGCTGG - Intronic
1063519937 10:6732141-6732163 CACAGAAAGACAAATACCACAGG - Intergenic
1064143523 10:12809632-12809654 CATAGAAAGACATATAATGCAGG + Intronic
1064431611 10:15275932-15275954 CTCAGAGAGGAAAATACTGCAGG + Exonic
1064808550 10:19166324-19166346 CACAGAGAGACAAATATGGCAGG + Intronic
1064914645 10:20442755-20442777 AACACAAACACAAACACTGCTGG + Intergenic
1065256646 10:23876228-23876250 AACAGAAATGCAAATGCTGCAGG + Intronic
1065377019 10:25053528-25053550 CACAGAAAGACAAATAGGGCAGG - Intronic
1065379927 10:25079586-25079608 TACAGAAAGGGAAAAACTGCAGG - Intergenic
1065614515 10:27505961-27505983 CACACACAGACAAATCATGCTGG - Intronic
1067047765 10:42994999-42995021 CACAAAAGGACAAATATTGTAGG + Intergenic
1067687202 10:48473236-48473258 CACAAAAAGACAAATACTACAGG + Intronic
1068182703 10:53543116-53543138 CACAGAAAGACAAATACCACAGG - Intergenic
1068317096 10:55359886-55359908 CACACAAAGACAAATAGCTCAGG + Intronic
1068547215 10:58360942-58360964 CTCAGAAAGAATAATACTTCAGG - Intronic
1068924673 10:62523506-62523528 CACAGAAATACAGATAATTCAGG - Intronic
1069052104 10:63806027-63806049 CACAGAAAGACAAACATTGCAGG - Intergenic
1069357584 10:67605265-67605287 CATAGAAAGAAAACTATTGCAGG + Intronic
1070406511 10:76102477-76102499 AACAGAAAGCCAAATACTGCAGG - Intronic
1070596699 10:77837804-77837826 CACAGGAAGAAAGAGACTGCAGG - Intronic
1071537407 10:86445811-86445833 CACAGTAAGAAATATACTGTAGG - Intronic
1072073576 10:91945532-91945554 CACAAGAAGACAAACACTGTAGG - Intronic
1072333950 10:94380788-94380810 CACAGAAAGACAAATACAAAGGG - Intergenic
1072454483 10:95564021-95564043 AACAGAAAGAAAAATCCTACTGG + Intergenic
1072881256 10:99232278-99232300 CACAGATACACAAACACAGCGGG + Intronic
1072940345 10:99758201-99758223 AACAGAAAGACAAATAGTGATGG - Intergenic
1073775562 10:106781857-106781879 CACAGAAATACAAACAGTGAAGG + Intronic
1074413989 10:113251146-113251168 CTCAGAAACAGAAAAACTGCTGG - Intergenic
1074451154 10:113560764-113560786 CCCAGAAGGACAAATATTGTAGG + Intronic
1074733788 10:116406460-116406482 AAGAGAAAGAGAAATAATGCTGG - Intergenic
1074781488 10:116805313-116805335 CGCAAAAAAACAAAAACTGCAGG + Intergenic
1075168768 10:120093621-120093643 CAGAAAAAGACAAATACTGCAGG - Intergenic
1075809025 10:125210830-125210852 CACAAAAACACCAAGACTGCAGG - Intergenic
1076436471 10:130448201-130448223 CAGAGAGAGAAAAATACTTCAGG - Intergenic
1076883413 10:133250757-133250779 CACAGAGAGACAGAGACAGCAGG + Intergenic
1076883545 10:133251295-133251317 CACAGAGAGACAGAGACAGCAGG - Intergenic
1077386976 11:2274344-2274366 CACAAAAAGACAGATGCTGTAGG - Intergenic
1077761854 11:5109765-5109787 CATGCAAAGACAAATACTGCAGG + Intergenic
1077939158 11:6821648-6821670 TACAGAAAGGCAAATACTACAGG + Intergenic
1078124208 11:8543492-8543514 CACAGAAAGACAAACATCACAGG + Intronic
1078515442 11:12018078-12018100 CACAGGAAGGCAAGCACTGCTGG - Intergenic
1078601855 11:12739526-12739548 CACAAAAGGACAAATACAGTAGG - Intronic
1078823188 11:14903771-14903793 CACAAAAGGACAAATATTGTAGG + Intergenic
1078887675 11:15521020-15521042 CACAGAAAGACAAATACCATGGG - Intergenic
1079092018 11:17487545-17487567 CACAGAAAGACAAACATCACAGG - Intergenic
1079461892 11:20688471-20688493 AACAGAAAATCAAATACTACAGG - Intronic
1079470183 11:20770569-20770591 CACAGATAGATAAATAGTGAGGG + Intronic
1079553110 11:21725830-21725852 TGCAGAAAGACAAATATTGTAGG - Intergenic
1080025413 11:27608609-27608631 TACAGAAATACATATACTGTTGG + Intergenic
1081030068 11:38068748-38068770 AACAGAAAGTCAAATCCTACAGG - Intergenic
1081213383 11:40363305-40363327 AACAAAAATCCAAATACTGCAGG + Intronic
1081581342 11:44354409-44354431 CACAGGAAAAGGAATACTGCAGG - Intergenic
1082131353 11:48493344-48493366 CACAGAAAGGCAAATATTGCAGG + Intergenic
1082564849 11:54664218-54664240 CACAGAAAGGCAAATATTGCAGG + Intergenic
1082660510 11:55904071-55904093 CACAGAAAGACAAATTGCTCAGG + Intergenic
1082743030 11:56931923-56931945 CACAGAAGAACAAATACTCTAGG - Intergenic
1082833213 11:57634753-57634775 AACAGAGAGACAACTGCTGCAGG - Intergenic
1082850717 11:57761962-57761984 CTGAGAAAGACAAATCCAGCAGG - Exonic
1082898871 11:58223988-58224010 CACAGAAAGACAAATACTGCAGG + Intergenic
1082950521 11:58810231-58810253 CTCAGAAAGACAAATGCTTCAGG - Intergenic
1082962497 11:58932692-58932714 CACAGAAGAACAAATTCAGCTGG + Intronic
1083528216 11:63392416-63392438 CCTAGAAAAACAAATACTGAGGG - Intronic
1084418225 11:69046617-69046639 CACAAAAGAACAAATACTGCAGG + Intergenic
1084578538 11:70007175-70007197 TACAGAAAGACAGTTACTGTTGG - Intergenic
1084676057 11:70635459-70635481 CACAAAAAGATAAATACTGCAGG + Intronic
1084686172 11:70697009-70697031 CACAGAAAGATGAATACTTCGGG + Intronic
1084724622 11:70933263-70933285 CACAAAAAGATGAATACTGTAGG + Intronic
1084726985 11:70948227-70948249 GACAGGAAGAAAAATACAGCAGG - Intronic
1084922132 11:72479736-72479758 CACAGAAAAACAAAAACTTAAGG + Intergenic
1085560663 11:77470688-77470710 CAGAGAAAGACAAAAACCACAGG + Intronic
1085727531 11:78967205-78967227 CACAGACAAGTAAATACTGCAGG - Intronic
1086633306 11:89050853-89050875 GACAGAAAACCAAATACTGCAGG + Intronic
1086982990 11:93219053-93219075 CACAGAAAAACAATTTCAGCAGG + Intergenic
1086985195 11:93240347-93240369 CACAGAAAGACAAACATCTCAGG + Intergenic
1087785925 11:102354126-102354148 CAGAGAAAGACAAATACAACTGG - Intronic
1087977788 11:104571240-104571262 CTCAGAAACACAAATCCTCCAGG - Intergenic
1088925428 11:114296467-114296489 CTCAGGAAGACAACTTCTGCAGG + Exonic
1089877110 11:121734815-121734837 AAAAAAAAGACAAATACTGTAGG - Intergenic
1091012333 11:132014137-132014159 CACAGAAAGACAAATATCACAGG - Intronic
1092567394 12:9682610-9682632 AACAGAAAACCAAATACTGCAGG - Intronic
1092765054 12:11845444-11845466 TACAGTAAGACAATTACAGCTGG - Intronic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1094344447 12:29451344-29451366 CACAGTAAGAGAAAGACGGCAGG - Exonic
1094616464 12:32040773-32040795 CAGGGAAGGACACATACTGCAGG + Intergenic
1095101141 12:38184822-38184844 CACAGAAAGAGAGACTCTGCTGG + Intergenic
1095195227 12:39306823-39306845 CAGAGCAAGACAAATGTTGCTGG - Intronic
1095242075 12:39872770-39872792 CAAAGAAAACAAAATACTGCTGG + Intronic
1095328582 12:40928962-40928984 CACATAAAGACAATTTCTACTGG - Intronic
1095502196 12:42852294-42852316 CACAGAAAGACAAATACCACAGG + Intergenic
1096920184 12:55075741-55075763 AACAGAAAACCAAATACCGCAGG - Intergenic
1096972648 12:55680350-55680372 CACATAAAACCAAATATTGCTGG + Intergenic
1097364532 12:58696656-58696678 AACAGAAAAGCAAGTACTGCAGG + Intronic
1097509084 12:60513731-60513753 CACAGAAAGACAAAGATTGCAGG + Intergenic
1097523699 12:60702531-60702553 CACAAAAAGACAAATACAGAAGG - Intergenic
1097596526 12:61639481-61639503 AGCAGAAAGTCAAATACTGCAGG - Intergenic
1097624921 12:61988444-61988466 TATAGAAAGACAAACTCTGCTGG + Intronic
1097770432 12:63578209-63578231 TACAGAAAGACAAACTTTGCAGG + Intronic
1098011679 12:66059875-66059897 GGCAGAAAAACAAATGCTGCTGG + Intergenic
1098066076 12:66617735-66617757 CACAGAAAAAGAAATACTACTGG + Intronic
1098194020 12:67980361-67980383 CACAGAAAGACAAATATTATAGG + Intergenic
1098853178 12:75622188-75622210 CACAGAAGAATATATACTGCAGG + Intergenic
1099013596 12:77320525-77320547 TACTGAATGACAAACACTGCGGG - Intergenic
1099052197 12:77793565-77793587 AACAGAAAACCAAACACTGCAGG - Intergenic
1099171673 12:79372059-79372081 CACAGAAAAAGAAATAATGAGGG - Intronic
1099400502 12:82197829-82197851 AACAGAAAACCAAATACTACAGG + Intergenic
1099516263 12:83600188-83600210 AACAGAAAACCAAACACTGCAGG + Intergenic
1100252486 12:92842084-92842106 CACAAAAAGACAAATACTGTTGG + Intronic
1100402165 12:94241605-94241627 CACAGAAAGACAAATATTGCAGG - Intronic
1100728640 12:97438341-97438363 CACAAAAAGAGAAATACTTTAGG - Intergenic
1101338312 12:103817417-103817439 CACAGGCAGACAAATGCTGAAGG + Intronic
1101980500 12:109402188-109402210 TGCAGAAAAACAAATATTGCAGG - Intronic
1102450770 12:113040466-113040488 CACAAAAAGAAAAACACTGCAGG - Intergenic
1103055282 12:117814996-117815018 CACAGAAAGGGAAATACAGATGG + Intronic
1103939163 12:124492631-124492653 CACAGAAAGACAGATCCCCCCGG - Intronic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1104114405 12:125735444-125735466 AAAAGAATGACAAAGACTGCTGG + Intergenic
1104346367 12:128003066-128003088 CACAAAAAGACAGATACCACAGG + Intergenic
1104385180 12:128344451-128344473 GACATAAAAACATATACTGCCGG - Intronic
1104406621 12:128523158-128523180 CACACAAGAACAAATACTGTAGG + Intronic
1104434245 12:128743142-128743164 CACCGGAAAACAAATCCTGCTGG - Intergenic
1104502393 12:129298724-129298746 CACAGAAAGACAAATACCGCAGG - Intronic
1104696356 12:130867015-130867037 GACAGATAGAAAACTACTGCAGG + Intergenic
1104842309 12:131830909-131830931 CACAGAAAGACAAAAAACTCAGG - Intronic
1104955279 12:132461863-132461885 CACAGAGAGACAAAGACCGGAGG - Intergenic
1105390854 13:19976654-19976676 CACAAAAAGACAAATACTGCAGG - Intronic
1105830006 13:24155927-24155949 CACAAAAGGACAGATACTGTAGG - Intronic
1106237760 13:27879192-27879214 CACAAAAAGACAAACACCGCTGG + Intergenic
1106489125 13:30200737-30200759 CACAGGAAGAAAATTACGGCTGG + Intergenic
1106755469 13:32818956-32818978 CCCAGAAAGACAAATATTGCAGG + Intergenic
1107116120 13:36747474-36747496 AACAGAAAACCAAATACGGCAGG - Intergenic
1107275014 13:38668239-38668261 CATAGAAAGACAAATCCTGCAGG + Intergenic
1108023529 13:46154319-46154341 CACAGAAATACACTTACTGCTGG + Intronic
1108542657 13:51458133-51458155 AAGAGAAAACCAAATACTGCTGG + Intergenic
1108962549 13:56253401-56253423 CAAAAAAATACAAAAACTGCAGG - Intergenic
1109031384 13:57194271-57194293 CACAGCAAGACAAACTTTGCAGG - Intergenic
1109335989 13:60994386-60994408 CACAGTAAGACAAATACTGCAGG - Intergenic
1109387925 13:61656909-61656931 AACAGAAAACCAAACACTGCAGG - Intergenic
1109510540 13:63367115-63367137 CATAGAAAGACAAATATCACAGG + Intergenic
1109807634 13:67465228-67465250 CACAGAGAGACAAATACTGGAGG - Intergenic
1110023873 13:70510954-70510976 CACAGAAAGAAAAATCCAACAGG - Intergenic
1110478272 13:75943699-75943721 AACAGAAAACCAAACACTGCAGG + Intergenic
1110538640 13:76682227-76682249 CACTGAAGGGCAAATACTGCAGG - Intergenic
1110547454 13:76771490-76771512 CACAAAAAGATAAATACTACAGG + Intergenic
1110555566 13:76855741-76855763 GGCAAAAAGACAAATACTGTTGG + Intergenic
1110884879 13:80620187-80620209 CACAGGAAGCCAAATAATACAGG - Intergenic
1110899715 13:80806002-80806024 TACAGAAAGACAAATATCACAGG + Intergenic
1110908586 13:80924840-80924862 AACAGAAAGTCCAGTACTGCAGG + Intergenic
1110971321 13:81765554-81765576 AACAGAAAACCAAACACTGCAGG - Intergenic
1111136970 13:84060125-84060147 CACAAAAAGACAGACATTGCAGG - Intergenic
1111152300 13:84270738-84270760 CACAAATAGACAAATACTGTAGG - Intergenic
1111265078 13:85799836-85799858 TACAAAAATACAAATATTGCAGG - Intergenic
1111550120 13:89798109-89798131 CACAGAGAAACAAATACCCCAGG - Intergenic
1111765535 13:92522517-92522539 AACAAAAAAACAAACACTGCAGG + Intronic
1111896676 13:94150578-94150600 CAGAGAAAGAAAAATGTTGCAGG - Intronic
1112035640 13:95493854-95493876 CACAAAAGGACAAATATGGCCGG - Intronic
1112358954 13:98699144-98699166 CGCAGAAAGCCAAAAACTCCAGG - Intronic
1113269029 13:108652645-108652667 CACTAAAAGATAAATACTGTAGG - Intronic
1113845950 13:113391682-113391704 CACAGAAGGACAAATTCTGTGGG - Intergenic
1114168362 14:20245082-20245104 CACAGAAAGACACATATAGGAGG + Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1114922307 14:27347986-27348008 AACAGAAAACCAAATACTGCAGG - Intergenic
1115321381 14:32082882-32082904 AAGAGATAGACAAATACTACAGG - Intronic
1115838467 14:37437630-37437652 CACAGTAAGACAGATGGTGCAGG + Intronic
1115925353 14:38427471-38427493 CACACAAAAACAGATACTGGGGG - Intergenic
1116096443 14:40376464-40376486 CACAGAAAGAGAAATACTGTTGG - Intergenic
1116780586 14:49233082-49233104 AACAGAAAGCCAAATACTCCAGG - Intergenic
1116935403 14:50734450-50734472 CACAAAAAGACAATTTCTACAGG + Intronic
1117711921 14:58539116-58539138 CACAGAAAGACAAACTTTGAAGG - Intronic
1118014618 14:61646923-61646945 CACAGAGACAAAAATTCTGCAGG + Intronic
1118125725 14:62901470-62901492 AACAGAAAACTAAATACTGCAGG - Intronic
1118324711 14:64773181-64773203 TAGAGAAAGACAAAAACAGCAGG + Intronic
1118558445 14:67051894-67051916 TTCAGAAAAACAAATACTGAGGG + Intronic
1119193428 14:72700186-72700208 CACAGAAGGAGAAACAGTGCTGG - Intronic
1121487929 14:94332859-94332881 GTCAGAAAGACAAATACTTCAGG - Intergenic
1122005729 14:98702004-98702026 AACAGAAAGTCAAATACTGCAGG - Intergenic
1122149416 14:99716934-99716956 GACAGAGAGACAAATACTGATGG + Intronic
1122285400 14:100648838-100648860 CCCAGAGAGAGAAACACTGCAGG + Intergenic
1122546469 14:102525446-102525468 CACAAAAAGACAAATACTGTAGG + Intergenic
1122576055 14:102742919-102742941 CACACAGAGAAAAATACTGCGGG - Intergenic
1123842884 15:24267218-24267240 AGCAGAAAACCAAATACTGCAGG - Intergenic
1124057885 15:26259399-26259421 CACAGAAAGACAAATACTGCAGG + Intergenic
1124184248 15:27509024-27509046 CTCAGAAAAACAAAAACTGAGGG - Intronic
1124357915 15:29011081-29011103 CACAAAAAGACAGAAACTGTAGG - Intronic
1124972484 15:34502383-34502405 CACAGAGTAACAATTACTGCAGG + Intergenic
1125244385 15:37618081-37618103 AACAGAAAAACAAATACCTCAGG - Intergenic
1125901137 15:43348921-43348943 AAAAGAAACACAAATACTCCTGG + Exonic
1126196774 15:45940078-45940100 AACAGAAAACCAAATACTGTAGG + Intergenic
1126288310 15:47042163-47042185 CACAGGATGACAAATGCTGCAGG - Intergenic
1127246875 15:57186629-57186651 CAAAGTAAGACAAATATTACAGG + Intronic
1128360486 15:66958253-66958275 CACAAGAAGACAAACACTGTAGG + Intergenic
1128596280 15:68953404-68953426 CACAGAAACTCATACACTGCTGG - Intronic
1129129970 15:73484898-73484920 AACAGAAAGACAATTCCTGTTGG - Intronic
1129972392 15:79790171-79790193 CACAAAAGGACAAATATTGTAGG + Intergenic
1130194877 15:81770319-81770341 CACAGAAAATTAAATAGTGCAGG - Intergenic
1130211155 15:81923824-81923846 AACAAAAAAACAAATACTGTAGG + Intergenic
1130302500 15:82690495-82690517 GACAGAAAACCAAACACTGCAGG - Intronic
1131029213 15:89172365-89172387 CACAAAAGGACAAATACTGTAGG - Intronic
1131085082 15:89569178-89569200 AACAGAAACTCAAATACCGCAGG - Intergenic
1131273771 15:90963327-90963349 CATAAAAAGACAAATACTATGGG - Intergenic
1131366003 15:91840613-91840635 CACACATAGACAAAAACTTCTGG - Intergenic
1131378287 15:91943328-91943350 CACAAAAGGACAGATACTGTAGG - Intronic
1131531467 15:93196553-93196575 CAAATAAAGACAAATGCTGGTGG + Intergenic
1132127404 15:99240211-99240233 CCCAGAATAACAAATACTGCAGG - Intronic
1132145807 15:99429075-99429097 CACAGAAAGACAAATACCGCAGG + Intergenic
1132187909 15:99819283-99819305 CACAGAGTAACAATTACTGCAGG - Intergenic
1132228046 15:100158677-100158699 TGCAGAAGGAAAAATACTGCAGG - Intronic
1132370263 15:101292342-101292364 CACAGAAATACAAATAATTCTGG + Intronic
1132791084 16:1688545-1688567 AACTAAAAGATAAATACTGCTGG - Intronic
1133881730 16:9788653-9788675 GAAAGAAAGACAAATAGTGTGGG - Intronic
1134448947 16:14351773-14351795 CACAGAAAGACAAATACCGCAGG - Intergenic
1135898841 16:26436152-26436174 CACACATAGACAAATATTACTGG - Intergenic
1136279520 16:29199761-29199783 CACCAAAAGACAAATGCCGCAGG - Intergenic
1137684577 16:50377350-50377372 CACAGAAAGAGAAATACTGCAGG - Intergenic
1137960801 16:52880139-52880161 CACAAAATGACAAATATTGTAGG + Intergenic
1138841796 16:60517903-60517925 CCCAGACAGGCAAATACTGAGGG + Intergenic
1138918243 16:61494539-61494561 AACAGAAAAGCAAATACTGCAGG - Intergenic
1138920419 16:61521854-61521876 CACTGGAAGAAAAATACTGTAGG + Intergenic
1139795794 16:69482052-69482074 CACAGAAAAACAACAACTCCAGG + Intergenic
1140157349 16:72445371-72445393 AACAGAAAACCAAACACTGCAGG - Intergenic
1140158579 16:72459941-72459963 CACAGTAAGTCAAACTCTGCAGG - Intergenic
1140354198 16:74290919-74290941 CACAGAAAGAGAGCTAGTGCTGG - Intergenic
1140387656 16:74555795-74555817 CACACAAAGACAATTATAGCTGG + Intronic
1140633980 16:76889052-76889074 AACAGAAAACCAAACACTGCCGG + Intergenic
1140646319 16:77034787-77034809 CACAGAAAGACAAACTTTGCAGG - Intergenic
1140959891 16:79901632-79901654 AACAGAAATCCAAACACTGCAGG - Intergenic
1141203785 16:81917137-81917159 CACAGAAAAACAAATACCACAGG - Intronic
1141299815 16:82803721-82803743 CACAGAAGGACAGAAACTGCAGG + Intronic
1141494699 16:84399999-84400021 CACAGAAAGGCAAACTTTGCAGG - Intronic
1142083911 16:88165862-88165884 CACCAAAAGACAAATGCCGCAGG - Intergenic
1142881904 17:2888509-2888531 CACAGAAACACACACACTGTGGG - Intronic
1142909572 17:3076546-3076568 CAAAGAAAGACAAAAACTGCAGG - Intergenic
1142924926 17:3227268-3227290 CAAAGAAAGACAAAAACTGCAGG + Intergenic
1144433136 17:15213557-15213579 CACTGCAAGACAAATACTGTGGG + Intergenic
1144573396 17:16414944-16414966 CTCAGAAAGACAAATTTTGGAGG + Intergenic
1144588551 17:16504229-16504251 CAAAAAAAAAAAAATACTGCAGG - Intergenic
1145034611 17:19532523-19532545 CACAGGAAGAGAAAGGCTGCCGG + Intronic
1145062260 17:19740551-19740573 CACCCAAAGACAGACACTGCTGG - Intronic
1145259468 17:21346177-21346199 CACAGAAGGACAAATGCTTAGGG - Intergenic
1145317149 17:21741771-21741793 CACAGAAGGACAAATGCTTAGGG + Intergenic
1146377407 17:32303876-32303898 GGCAGAAAGCCAAATTCTGCAGG - Intronic
1146592759 17:34142363-34142385 GACAGAAATACATATAGTGCTGG + Intronic
1146927747 17:36756664-36756686 CACAGAAGGACAAATATTGTAGG - Intergenic
1146971607 17:37077242-37077264 TGCAAAAAGACAAATACTGTAGG - Intergenic
1147973113 17:44230513-44230535 CTCAGAAAGTTAAAAACTGCAGG - Intergenic
1148003420 17:44404812-44404834 AACAGAAAATCAAACACTGCAGG + Intronic
1148583591 17:48760917-48760939 CACAGACAGCCAAATAATTCTGG + Intergenic
1149976164 17:61268554-61268576 CCCAGAAAGACAATTACTGGTGG - Intronic
1150483173 17:65526293-65526315 CACGGATTGACAAATACTGCAGG + Intergenic
1151011005 17:70495948-70495970 TACAGGAAGACAAATACTGTAGG + Intergenic
1151072479 17:71231683-71231705 CATGCAAAGACTAATACTGCAGG + Intergenic
1151167002 17:72212472-72212494 CACAGAGAGCCTAGTACTGCTGG - Intergenic
1151873783 17:76854536-76854558 CACAAAAAGACAAATACTATGGG - Intergenic
1152966097 18:115483-115505 CATATAAAAACAAATACTGTTGG - Intergenic
1153072639 18:1123526-1123548 AACAGAAAACCAAACACTGCAGG - Intergenic
1153683685 18:7524656-7524678 CTGAGAAAGGCAAATAATGCAGG - Intergenic
1153730396 18:8005629-8005651 TGCACAAAGAAAAATACTGCTGG - Intronic
1153735757 18:8065402-8065424 AACAGAATGAAAAATGCTGCAGG + Intronic
1154295812 18:13146387-13146409 CACAAAAAGAAAAATGCTACAGG + Intergenic
1154927872 18:20956572-20956594 CATATAAAAACAAATACTGTTGG + Intronic
1155338398 18:24789032-24789054 CACTAAAAGAAAAATACTGGAGG - Intergenic
1155684864 18:28536286-28536308 AACAGAAAACCAAATACTGCAGG + Intergenic
1155685101 18:28538841-28538863 AACAGAAAGACAAATAAAGAGGG - Intergenic
1156017447 18:32562463-32562485 CATAGAAAGACAAAGAATTCAGG - Intergenic
1156652551 18:39241621-39241643 AACAAAAAGACAAAGACTGTAGG + Intergenic
1157018387 18:43747252-43747274 AACAGAAACCCAAATACAGCAGG + Intergenic
1157053488 18:44197935-44197957 CACAGGAAGACAGAGACTACAGG - Intergenic
1157119644 18:44896831-44896853 AACAGAAACACAAATAATGGTGG - Intronic
1157310839 18:46551949-46551971 CACAAAAAGACAAATTCTGTAGG + Intronic
1157474627 18:48013909-48013931 CACAGATAGACAAATAGACCAGG - Intergenic
1157684913 18:49634663-49634685 CACAGAACAACATGTACTGCTGG - Intergenic
1158352768 18:56579751-56579773 CTCAGACAGACAAAAACTGAGGG + Intergenic
1158582931 18:58701091-58701113 CACAGAAGGACAATTAAAGCAGG - Intronic
1158750969 18:60260425-60260447 CACAGAAAGACAAATAACTCGGG - Intergenic
1159075192 18:63673399-63673421 AACAGAAGGACACATATTGCCGG + Intronic
1159150874 18:64522227-64522249 AACAGAAAGACGAAGACTGCAGG + Intergenic
1159420312 18:68210500-68210522 AACAGAAAATCAAATACTGCAGG + Intergenic
1159441941 18:68492640-68492662 CAAAGAAAAAAAAATACCGCAGG + Intergenic
1159478471 18:68956057-68956079 CACAGAAAGACAAACTTTGCAGG - Intronic
1159686966 18:71434657-71434679 CACAGAAAGACAAATATCACAGG + Intergenic
1159710964 18:71759344-71759366 CATAGAAAAACAAACACTGTTGG + Intronic
1159821044 18:73143806-73143828 AACAGAAAGACAAATACTGTAGG - Intergenic
1160036500 18:75306253-75306275 CACAAAAAGACAAATACTGTAGG - Intergenic
1160181593 18:76641504-76641526 CACAGAAAGACAAGTACTGCAGG - Intergenic
1160189078 18:76700037-76700059 CACAGAAGGACAAATATGCCTGG - Intergenic
1160595445 18:79970532-79970554 CTCAGAAAGACGAATCCTGTTGG - Exonic
1160782171 19:882708-882730 CACAGAAACAGAAACAGTGCAGG + Intronic
1161526522 19:4759576-4759598 GACAGACAGACAAACACGGCAGG - Intergenic
1161749574 19:6084931-6084953 CACAAAAGGACAAATCCAGCCGG - Intronic
1162160522 19:8711267-8711289 CACAAAAAGTCAAATACTGTAGG + Intergenic
1162610342 19:11745063-11745085 CACAGAAGGACAAATATTGTAGG + Intergenic
1162868511 19:13567657-13567679 TACACATAGACAAATACTGCAGG - Intronic
1163059170 19:14745839-14745861 CACAAAAAGACAAATACCACAGG - Intronic
1164527909 19:29025426-29025448 GACAGCAACACAAATACTGTAGG - Intergenic
1164541968 19:29128205-29128227 CACAGATAGACACATACAGAGGG + Intergenic
1164645191 19:29854126-29854148 AACAAAAAGGCAGATACTGCAGG - Intergenic
1164662962 19:29994513-29994535 CACAAAAGGACAAATGCTGTAGG - Intronic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1167110204 19:47456207-47456229 CACAGAAATATAAAGAATGCAGG + Intronic
1167138014 19:47629418-47629440 GACAGTATGACAAATACTACAGG - Intronic
1168086651 19:54052517-54052539 CTCAGAAAGACAAATTCTGCAGG - Intronic
1168397253 19:56058954-56058976 CCTAAAAAGACAAATACTGTAGG + Intronic
1168500721 19:56890609-56890631 TACAAAAAGACAAATGCTGTAGG - Intergenic
1168521713 19:57056438-57056460 AACAGAAAGTCAAATACTGCAGG + Intergenic
925038348 2:709435-709457 CACAAAAAGACAAACGCTGCAGG - Intergenic
925250234 2:2427905-2427927 CACACAAACACAAATCCAGCAGG - Intergenic
925732863 2:6934291-6934313 CACAGAAAGAGAAATACTAGTGG - Intronic
925954277 2:8946797-8946819 CAGAGGAAGACAGAGACTGCCGG - Intronic
925957675 2:8984153-8984175 CACAAAAAGACAAACACTATAGG + Intronic
926927587 2:18003268-18003290 AACAGAAAACCAAACACTGCAGG + Intronic
927033994 2:19152659-19152681 CACAGAAAGACAAATATTTCAGG - Intergenic
927129840 2:20049739-20049761 AACAGGAAGACTAAGACTGCAGG + Intronic
927824077 2:26295298-26295320 CACAAAAGGACAAATTCTGTAGG + Intergenic
928469561 2:31560424-31560446 AACAGAAATACAAAAAGTGCTGG - Intronic
928488182 2:31754094-31754116 CCCAGAAAGACAAATGCAGAAGG + Intergenic
928655814 2:33450467-33450489 CACAGAAAGACAAGTTCTGCAGG - Intronic
929324302 2:40588809-40588831 CACAGAAAGACAAACATCACAGG + Intronic
929373366 2:41253947-41253969 CACAGAAAAAAAAATAGTGATGG + Intergenic
929657890 2:43752307-43752329 TACACAAAGACAAATAATGCAGG - Intronic
930929902 2:56868771-56868793 AACAGAAAACCAAACACTGCGGG + Intergenic
931167701 2:59766426-59766448 CACAGAAAAACAAATATCTCAGG - Intergenic
931824341 2:65984199-65984221 CACAGGAAGATAAAAACTGGAGG - Intergenic
933262328 2:80144675-80144697 TACAGACAGACAAATACAACTGG - Intronic
933444379 2:82359879-82359901 CACAGAAAGACAAATACTGCAGG - Intergenic
933470580 2:82717841-82717863 CAAAGAAAGAAAAACATTGCTGG + Intergenic
933534233 2:83552241-83552263 AACAGAAAACCAAACACTGCAGG - Intergenic
934582166 2:95451593-95451615 TACAGAATCACACATACTGCAGG - Intergenic
934597284 2:95625121-95625143 TACAGAATCACACATACTGCAGG + Intergenic
934783020 2:96985004-96985026 CAAAGAAAGACACAAACTGTGGG + Intronic
935504401 2:103882300-103882322 GAGAGAAAGAAAAATAGTGCTGG + Intergenic
936752488 2:115662109-115662131 CACACAAAGAAAAATACTCTAGG - Intronic
936801638 2:116275891-116275913 GACAAAATGACAAATATTGCAGG - Intergenic
936988452 2:118335199-118335221 CACAAAAAGTCAAATACTTGAGG - Intergenic
937525404 2:122762614-122762636 CACAGAAAAACAAAAGCTGAAGG - Intergenic
938177332 2:129145525-129145547 CACAGAAAGACAAATACTGCAGG - Intergenic
938226594 2:129621908-129621930 TGCAGAAAAACAAATACTGCAGG + Intergenic
938473599 2:131588678-131588700 GACAGAAGGACAAATACTACGGG + Intergenic
938930582 2:136083204-136083226 AAAAGAATGACAACTACTGCTGG + Intergenic
939343910 2:140937344-140937366 CAAACAAAAACAAATACTGTAGG + Intronic
939375515 2:141360559-141360581 AAAAGAAAGACATATACTCCAGG + Intronic
939801350 2:146714026-146714048 CACAGGGACACAAAAACTGCGGG + Intergenic
940215749 2:151301715-151301737 CACAGAAAGACAAATATTGCAGG + Intergenic
940440268 2:153707048-153707070 CAAAGAAAGAGAAATCGTGCAGG - Intergenic
940825807 2:158410904-158410926 CTCAGATAGACAAAAACTGAAGG - Intronic
941651884 2:168101106-168101128 AACAGAAAACCAAACACTGCAGG + Intronic
941670999 2:168292163-168292185 AACAGAAAACCAAACACTGCAGG - Intergenic
941687846 2:168465629-168465651 CACAAAAAGACAAATACTGTAGG + Intronic
941698723 2:168580924-168580946 TACAGAAAGACAAAGACTAAGGG - Intronic
941708169 2:168681879-168681901 CACCGAAAGACAAGTACCTCAGG - Intronic
942053176 2:172159646-172159668 CACAGAAAGAAAAATATTGCAGG - Intergenic
942593589 2:177571339-177571361 CACTTAAAGACAACTTCTGCTGG - Intergenic
943152465 2:184131947-184131969 AACAGGAAAACAAATACTACAGG - Intergenic
943545664 2:189273747-189273769 CACAGAAAGACAAATATCATGGG + Intergenic
944371380 2:198987312-198987334 AACAGAAAACCAAATACTGCAGG + Intergenic
944430932 2:199632990-199633012 CAAAGAAATACAAATACAGCTGG + Intergenic
944526881 2:200628574-200628596 CACTTAAAGACAGATAATGCCGG - Intronic
944751102 2:202710804-202710826 CAGAGAAAGACAAACTTTGCAGG - Intronic
944894249 2:204147730-204147752 CACAGAAAGGAAAATATTGCAGG - Intergenic
945177392 2:207056475-207056497 AACAGAAAAGCAAATACCGCAGG + Intergenic
945255916 2:207802986-207803008 CACAAAAAAACAAATACTGTAGG - Intergenic
945821548 2:214671792-214671814 CACAGAAAGACATTTCCTGTTGG - Intergenic
947066389 2:226230660-226230682 CACAGAAAGACAAACACTGGAGG + Intergenic
947265975 2:228281942-228281964 CATAAAAAGACAAATACTGTAGG + Intergenic
947355480 2:229290258-229290280 CACAGATAGACAAATACCACAGG - Intergenic
948077857 2:235180289-235180311 CACAGAAAACCAAATACTGCAGG - Intergenic
1169223209 20:3839102-3839124 CACAGAAAGACATATCCTTCTGG + Intergenic
1169666265 20:8040009-8040031 AACAGAAAAACAAACACTACTGG - Intergenic
1169801132 20:9513889-9513911 AACAGAAGAACAAATACTACTGG - Intergenic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1170238760 20:14138498-14138520 CACATAAGGACAAATACTGCAGG + Intronic
1170346749 20:15395313-15395335 AACAGAAAGACAAATAAGGTTGG - Intronic
1170947247 20:20902240-20902262 CTCAGAAAGCCAAATCCTGATGG - Intergenic
1171441058 20:25163376-25163398 CACAGAAAGACAAATGCGGCAGG - Intergenic
1171445468 20:25199723-25199745 CACAAAAAGACAAATATTGTAGG - Intronic
1171980018 20:31621257-31621279 CACAGATTGAAAAAGACTGCTGG + Intergenic
1172719428 20:36988115-36988137 CATAGAAAGCCAATCACTGCTGG - Intergenic
1173328578 20:42055485-42055507 CTTAGAAAAACAAATACTGCTGG - Intergenic
1173388731 20:42612120-42612142 CACAGGAAGACAACTGATGCAGG + Intronic
1173639848 20:44593504-44593526 CACAGAAAGACAAATACTACAGG + Intronic
1175004816 20:55670724-55670746 AACAGAAAACCAGATACTGCAGG - Intergenic
1175405174 20:58721425-58721447 CACAAAAACACAAATACTGTAGG + Intergenic
1175917091 20:62431076-62431098 GACAGAAAGACAAATACTGCAGG - Intergenic
1176339115 21:5627432-5627454 CACAAAAAGAGAAAAGCTGCAGG + Intergenic
1176340523 21:5690505-5690527 CACAAAAAGAGAAAAGCTGCAGG + Intergenic
1176456942 21:6921503-6921525 CACAAAAAGACAAATACTATGGG - Intergenic
1176472777 21:7122658-7122680 CACAAAAAGAGAAAAGCTGCAGG + Intergenic
1176504304 21:7633951-7633973 CACAAAAAGAGAAAAGCTGCAGG - Intergenic
1176835115 21:13786563-13786585 CACAAAAAGACAAATACTATGGG - Intergenic
1176874148 21:14110722-14110744 CACACAAAGACAAAGACTGTAGG - Intronic
1177449119 21:21242582-21242604 CACAGAAAGACTACTTCGGCAGG - Intronic
1178098257 21:29238442-29238464 CACAGAAAGATAAATTTCGCAGG - Intronic
1178459314 21:32787817-32787839 CATAGATAGACAAATACAGCAGG - Intergenic
1178755968 21:35350020-35350042 CACAGGAAGAAAATTATTGCAGG - Intronic
1178949427 21:36974188-36974210 CACAGAGAAACAACTGCTGCTGG + Intronic
1179222987 21:39426067-39426089 CACACAAAGAAGAATACTGGGGG - Intronic
1179531247 21:42021069-42021091 CACAGTGGGACAAATCCTGCAGG + Intergenic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1180601421 22:17020566-17020588 CACAGAGAGACAAATAACACAGG + Intergenic
1180926787 22:19560686-19560708 CACAGAAAGACAAATACCACAGG + Intergenic
1182675293 22:32034478-32034500 CACAGAGAGACGACTTCTGCAGG + Intergenic
1182698994 22:32217362-32217384 CACAGAAAGACAAATGCTATAGG - Intergenic
1184290951 22:43497990-43498012 TACAGAAAAACAGAAACTGCAGG + Intronic
1203239784 22_KI270733v1_random:4963-4985 CACAAAAAGAGAAAAGCTGCAGG + Intergenic
950480343 3:13239777-13239799 CACAGAAGGACGAAGCCTGCAGG + Intergenic
950484107 3:13262807-13262829 CACAAAAGAACAAATATTGCAGG + Intergenic
951285164 3:20802331-20802353 AACAGAAAGATAAATACCACAGG + Intergenic
951737030 3:25877815-25877837 CACAGAAAGACAAATAAGAACGG - Intergenic
952117540 3:30200628-30200650 AACAGAAAACCAAACACTGCAGG - Intergenic
952121932 3:30255621-30255643 AGCAGAAAACCAAATACTGCAGG + Intergenic
952332806 3:32380327-32380349 ACCAGAAAGACAAATACCGCAGG + Intergenic
952537618 3:34328808-34328830 CACAGAAAGGCAAATACCACCGG - Intergenic
952674176 3:36007288-36007310 CACAGAAAGAAAAATACTGTGGG + Intergenic
953513131 3:43563749-43563771 CACAGAAAGACAAATATCACAGG + Intronic
953799805 3:46013755-46013777 CAAAGAAAGAGAAAAGCTGCTGG - Intergenic
954282382 3:49591403-49591425 CACAAAAAGACAAAGAGTGCTGG - Intronic
954506323 3:51078403-51078425 CAAAGAAAGAAAATTACTGAAGG + Intronic
954917221 3:54158652-54158674 CACAGAAAAACAAGCACTGTGGG - Intronic
954925768 3:54233027-54233049 ACCAGAAAGACAAATATGGCGGG + Intronic
955147829 3:56337633-56337655 TACAGAAAAAAAAACACTGCTGG + Intronic
955358834 3:58255016-58255038 CATAGAATGAAAAATACTTCAGG - Intronic
955602903 3:60667414-60667436 AACAGAAATAAAAATAGTGCTGG - Intronic
955771851 3:62392659-62392681 CATAAGAAGACAAATACTGGTGG - Intergenic
955912196 3:63868695-63868717 CACAGAGAGAAATATAATGCTGG - Intronic
955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG + Intronic
956027564 3:64999736-64999758 CACAAAAAAACTAATATTGCAGG + Intergenic
956037204 3:65106994-65107016 CACATAAAGGCAAATTCTACTGG - Intergenic
956678993 3:71760325-71760347 AACAGAAAGATAAAAAGTGCAGG + Intergenic
957399637 3:79692565-79692587 CACAGGAAGACAAGTCCTGCAGG + Intronic
957731907 3:84150209-84150231 GACAGAAAAACAAATATTGATGG - Intergenic
957849249 3:85784734-85784756 CACACAAAGGCAAAAACTACAGG - Intronic
957904182 3:86536802-86536824 CAGAGAAAGAAAATTACTGCAGG + Intergenic
957954114 3:87161498-87161520 CACAGATATATAAATACTTCAGG - Intergenic
958758068 3:98274195-98274217 CAGAGAAAGACAAAAAGTGCTGG - Intergenic
958825501 3:99025482-99025504 TACAGAAAGACAAATACACATGG - Intergenic
959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG + Intergenic
959680350 3:109088962-109088984 AACAGAAAACTAAATACTGCAGG + Intronic
959743527 3:109748997-109749019 AACAGAAAACCAAATACTGTAGG - Intergenic
960591603 3:119371851-119371873 AACAGAAAACCAAATAGTGCAGG - Intronic
960748695 3:120920733-120920755 CACAGAAAAACAAATATCACAGG - Intronic
961002352 3:123382667-123382689 CACAAAAGGACAAATATTGTGGG + Intronic
961769427 3:129237926-129237948 CATAAAAAGACAAATACGGGCGG - Intergenic
962321088 3:134390978-134391000 AACAGAAAGACAAAAAGAGCTGG - Intergenic
962849946 3:139300935-139300957 CACAGAACGATAAATACTTTAGG + Intronic
963093329 3:141507915-141507937 CACAGGAAGACATACACTGAAGG + Intronic
963324538 3:143847433-143847455 CCCAGAAAGAGCAATACTGCAGG + Intronic
963418545 3:145029177-145029199 CACAGAAAGACAAATTTTGCAGG + Intergenic
963488275 3:145964969-145964991 TTCATAAAGACAAATACTTCTGG - Intergenic
963612233 3:147484612-147484634 AACAGAAAACCAAATACCGCAGG - Intronic
964235261 3:154518412-154518434 AACAGCAAAACAAATACTGTAGG - Intergenic
964312453 3:155409330-155409352 GAGACAAATACAAATACTGCAGG + Intronic
964366346 3:155954509-155954531 AGCAGAAAATCAAATACTGCAGG - Intergenic
964703756 3:159596698-159596720 GACAGAAAACCAAACACTGCAGG + Intronic
965016379 3:163163302-163163324 CACAGGAAGACAAATATCACAGG - Intergenic
965262041 3:166499540-166499562 AACAGAAAAACAAATACCACAGG - Intergenic
965854930 3:173075669-173075691 CACAGAAAGACAAATATCACAGG + Intronic
967480288 3:189964849-189964871 GAGAGAAAAAGAAATACTGCTGG + Intronic
967786066 3:193497813-193497835 CACAATAAGGCAAATACTGTAGG + Intronic
968780842 4:2580176-2580198 AACAGAAAACCAGATACTGCTGG + Intronic
968840238 4:2998466-2998488 CACATAAAGAAAAAGACTGTTGG + Intronic
968943313 4:3650681-3650703 CACAAAAGGACAAATCCTGTAGG - Intergenic
969369513 4:6722894-6722916 CACAAAACGATGAATACTGCAGG - Intergenic
969371865 4:6736668-6736690 CACAAAAGAACAAATACTGCAGG - Intergenic
969414336 4:7048813-7048835 CAGAAAAGGACAAATCCTGCAGG - Intronic
969877725 4:10148319-10148341 CACAGAGAATCAAATTCTGCAGG + Intergenic
969923717 4:10565204-10565226 GACACAAAGACAAACAATGCAGG - Intronic
970311069 4:14783103-14783125 CACAGAAAGGCAGACACTGATGG - Intergenic
970314239 4:14814236-14814258 CAAAGAAACAAAAATACAGCAGG + Intergenic
971711952 4:30124469-30124491 CACATAAATACAACAACTGCTGG - Intergenic
971818638 4:31523099-31523121 CATAGAAAGACAAATATTGGAGG - Intergenic
972625913 4:40798506-40798528 CACAAATAAATAAATACTGCAGG - Intronic
973223978 4:47761615-47761637 CACAGAAAGACAAATACCACAGG + Intronic
973227220 4:47800553-47800575 CACAAAAAGACAACTACTGAAGG + Intronic
973813524 4:54596673-54596695 CACAGAAAGACAAATACTGTAGG + Intergenic
974586188 4:63881153-63881175 CACACACATACAAATAATGCAGG + Intergenic
974590753 4:63944788-63944810 AACAGAAAAACATATACTGCAGG - Intergenic
974677883 4:65118715-65118737 CACAAAAGGGCAAATACTGTAGG - Intergenic
974784599 4:66602123-66602145 CACAGAAAGATAAATACCCTGGG + Intergenic
975022654 4:69508602-69508624 AGCAGAAAACCAAATACTGCAGG + Intronic
975411122 4:74051496-74051518 CACAGAGAAACAAATGCTGAAGG - Intergenic
975952504 4:79790430-79790452 CATAGAAAGATAAATGCTGAAGG - Intergenic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
977180385 4:93866570-93866592 TACAGAAAGACAAATACATTTGG + Intergenic
977587368 4:98788583-98788605 CACAGAAAGACAAATACTGTAGG + Intergenic
977724029 4:100273473-100273495 AAAAGAAAGACAAATAATGAAGG - Intergenic
978037809 4:104017905-104017927 CATAGAAAGATAAATACCACAGG + Intergenic
978820899 4:112964422-112964444 CACAGAAAGACAAACTTTTCAGG - Intronic
979172434 4:117618828-117618850 CATCAAAAGACAAATATTGCAGG + Intergenic
979896823 4:126168787-126168809 CACTGAAACATAAATAGTGCTGG + Intergenic
982047583 4:151464185-151464207 TACAGAAATAAAAATATTGCTGG - Intronic
982519990 4:156404332-156404354 CACAGAAGGACAAATTCTACAGG + Intergenic
982934272 4:161451401-161451423 CACAGAAACAGAAAAACTGGAGG + Intronic
983176719 4:164596803-164596825 TACCGAAAGAAAAATACCGCAGG + Intergenic
983195479 4:164801860-164801882 CACAGAATGACAAATTTTCCTGG - Intergenic
983370835 4:166856012-166856034 TACAGAAAGACAAATATGGCAGG + Intronic
983395533 4:167189869-167189891 CTCAGAAAGACAAATATTGTAGG - Intronic
983541742 4:168918433-168918455 CACAGAAAGATAAATACTACAGG + Intronic
983631743 4:169856430-169856452 CATGGAAAGACAAATACTGTAGG + Intergenic
983970945 4:173873600-173873622 TACAGAAAGACAAATTTTGCAGG + Intergenic
984099791 4:175471690-175471712 CACAGAAAGACAAATACTACTGG - Intergenic
984469627 4:180151660-180151682 AAAAGAAAGAAAAATACCGCTGG - Intergenic
984606731 4:181794532-181794554 CAAAGAAAAACAAATACTGCAGG - Intergenic
984614543 4:181882006-181882028 TTCAGAAAGTCAAACACTGCAGG + Intergenic
985081469 4:186269494-186269516 CACAAAAGAACAAATACTGTGGG + Intronic
985178232 4:187226287-187226309 CACAGAAAGATGAATACTGCAGG - Intergenic
986355497 5:6921074-6921096 CACAGAAACGTAAACACTGCAGG + Intergenic
986810806 5:11357427-11357449 CACAGAAAGACAAATACCACAGG + Intronic
986825543 5:11517921-11517943 CGGACACAGACAAATACTGCAGG + Intronic
986906260 5:12497038-12497060 CATAGAAACACAAATACTGCAGG + Intergenic
987158936 5:15120096-15120118 CACAGAAACAAAAAGACTGTTGG - Intergenic
987796286 5:22631533-22631555 GACAGAAACCCAAATACTGCAGG + Intronic
988003160 5:25375482-25375504 AACAGAAAGCCATATACTACAGG - Intergenic
988308990 5:29532554-29532576 AACAGAAAAACAAATACCACAGG - Intergenic
988860931 5:35277904-35277926 CACAGAAAGACAAATACCACAGG - Intergenic
990330161 5:54717934-54717956 CACAGAAGGACAAATATTTCAGG + Intergenic
990807146 5:59677215-59677237 TACAGAAAGGCAAATGCTGGGGG + Intronic
991007920 5:61848858-61848880 CACAAATAGACAGATACAGCAGG + Intergenic
991906583 5:71519552-71519574 CACAGAAAGACAAATATTGCTGG - Intronic
992003399 5:72456178-72456200 CACAGTGAGACAAATAGGGCAGG + Intronic
992020024 5:72613612-72613634 CCCAGAAAAACAAATACTGCAGG - Intergenic
992095061 5:73355323-73355345 CACAGAAACAGAAAGACTGGTGG - Intergenic
992309752 5:75483771-75483793 CACAGAAAAACAAAAGCTGAGGG + Intronic
992632324 5:78693933-78693955 CAGAGAAAGCAAAATAGTGCGGG + Intronic
992966518 5:82007109-82007131 CATTAAAAGACAAATACTGTGGG - Intronic
993093577 5:83456996-83457018 CACAGAAAGACAAATACTGCAGG + Intergenic
993196178 5:84749420-84749442 CACAGGAAGACAAATATCCCTGG - Intergenic
993518043 5:88862500-88862522 TAAAGAAAGACAAGTACTTCAGG - Intronic
993669826 5:90747130-90747152 GACAGAATGACAAAGACTGGTGG + Intronic
993680906 5:90876438-90876460 CACAGGAGGACAAAGGCTGCAGG + Intronic
993790310 5:92199560-92199582 ACCAGAAAGAAAAAGACTGCAGG - Intergenic
994274299 5:97816647-97816669 CACAGAAAGACAAACATCACAGG - Intergenic
994899190 5:105747787-105747809 AACAGAAAACCAAATACTGCAGG - Intergenic
994944764 5:106372645-106372667 CACAAAAAGACAAATGCCGTAGG + Intergenic
995099614 5:108283442-108283464 GGCAAAAAGACAAATAGTGCTGG + Intronic
995311144 5:110713146-110713168 CACAGAAAGACAAACATCACAGG + Intronic
995971411 5:117975351-117975373 CACAGAAAGACAGATACCACAGG - Intergenic
996055863 5:118981743-118981765 CACAGACAGACAAAGAATTCAGG + Intronic
996173479 5:120325244-120325266 CACAGAAAGACAAATACCATAGG + Intergenic
996501770 5:124224792-124224814 CACAGAAAGAAATAGACAGCCGG - Intergenic
997049790 5:130366099-130366121 CACAGGAAGGCAAATACTGCAGG - Intergenic
997079316 5:130719472-130719494 AATAGAAAGTCAAATACTGCAGG + Intergenic
997954926 5:138271872-138271894 AACAGAAAAGAAAATACTGCCGG - Intronic
998615937 5:143740642-143740664 GACAGAAAGTGAAATTCTGCTGG - Intergenic
999456516 5:151720855-151720877 CAGAGAAAGACAGATGCTCCTGG + Intergenic
1001151539 5:169232950-169232972 CACAGAAAGACAGACATTACTGG - Intronic
1001776595 5:174333411-174333433 CACAGAGGGACAGATGCTGCAGG - Intergenic
1002286690 5:178167233-178167255 AACAGAAAACCAAACACTGCAGG - Intergenic
1002310883 5:178313089-178313111 CACAGAAAGACAAATACGGAAGG + Intronic
1002597984 5:180336524-180336546 CAAAGAAAGACACATTCAGCTGG - Exonic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1002864990 6:1113910-1113932 CACAGAAGAACAAATACTACAGG + Intergenic
1003434896 6:6078918-6078940 CACAAAAAGACAAACATGGCAGG + Intergenic
1004546204 6:16600944-16600966 CACAGGAAGACAACTGCAGCAGG - Intronic
1004856719 6:19758511-19758533 CCCAGAGAGACAAATCCTGGTGG - Intergenic
1004942109 6:20569699-20569721 CACACAAAGGAAAATGCTGCAGG - Intronic
1005493109 6:26365032-26365054 CACAGAAACACAAACACTAAGGG + Intergenic
1005502350 6:26440334-26440356 CACAGAAACACAAACACTAAGGG + Intergenic
1005896025 6:30179744-30179766 CCCAGACAGGCAAATACTGAGGG - Intergenic
1005901861 6:30223368-30223390 TACAGAAAGAGAAATACAACTGG - Intergenic
1007014491 6:38450159-38450181 GCCAGAAAGACAAATACTGCAGG + Intronic
1008242887 6:49133753-49133775 AACAGAAAATCAAATACCGCAGG + Intergenic
1008298055 6:49802568-49802590 AACAGAAAAACAAATACTGCAGG - Intergenic
1008738152 6:54572427-54572449 GACAGAAAACCAAACACTGCAGG - Intergenic
1008904393 6:56660111-56660133 TACAGATAGAAAAAGACTGCTGG + Intronic
1009305713 6:62087520-62087542 AACAGAAAGTGAAATACTGAAGG + Intronic
1009522538 6:64701595-64701617 CTTAGAAAATCAAATACTGCAGG + Intronic
1009803703 6:68574828-68574850 CACAGAAAGACAAATATTCCAGG + Intergenic
1010720228 6:79274919-79274941 CACAGATTGAAAAACACTGCTGG - Intergenic
1011054320 6:83189883-83189905 CACATGAAGACAAATACTGCAGG + Intronic
1011306059 6:85928097-85928119 CACAGAAAGACAAACTTTACAGG - Intergenic
1011456490 6:87555968-87555990 CAAAGAAAGAAAAGTACTGAGGG + Intronic
1011596045 6:89017440-89017462 CACAGAAAAACAAACATTGCAGG + Intergenic
1011725029 6:90202427-90202449 CAGAGAAAAAAAAATTCTGCTGG + Intronic
1011990425 6:93508707-93508729 AACAGAAAACCAAATACTACAGG - Intergenic
1012559881 6:100567649-100567671 AACAGAAAACCAAATTCTGCAGG - Intronic
1012733333 6:102909169-102909191 CACAGAAAGACAGATGCCTCAGG - Intergenic
1013354022 6:109331834-109331856 CACAGAAACTCAATTGCTGCTGG + Intergenic
1014356118 6:120412086-120412108 AACAGAAAACCAAATACTACAGG - Intergenic
1014678639 6:124399845-124399867 CACAGTAATACAAAAATTGCTGG + Intronic
1015052654 6:128861616-128861638 CCCAAAAAAACAAATACTGAGGG - Intergenic
1016955115 6:149619314-149619336 AGCAAAAAGACAAAAACTGCTGG + Intronic
1017432884 6:154388255-154388277 AACAGAAAGACTAATATGGCAGG - Exonic
1017534244 6:155329508-155329530 CACACACAGACACACACTGCTGG + Intergenic
1017663289 6:156694758-156694780 CACAGAAGGACAAATACTGTGGG + Intergenic
1018652589 6:166004625-166004647 CACAGAAGGACAAACCCTGCAGG - Intergenic
1019096398 6:169584163-169584185 CACAAAAAGAAAAAGACTGCAGG - Intronic
1019311861 7:366218-366240 CACAGGAAGAGAAATACCGCAGG - Intergenic
1019538421 7:1540609-1540631 CACACACAGACACATCCTGCGGG - Exonic
1019773799 7:2900271-2900293 CACAAAAAGACAAATATTGTAGG - Intergenic
1019818899 7:3224550-3224572 CTCAGAAAAACAAAAACTGATGG - Intergenic
1020362639 7:7345549-7345571 CACAAAAAAACAAAAACTGAAGG - Intergenic
1020792727 7:12645736-12645758 AACAGAAAACCAAATACTGCAGG - Intronic
1020801892 7:12742416-12742438 CGCAGAAGGAGAACTACTGCAGG - Intergenic
1021046627 7:15930776-15930798 AACAGAAAACCAAATAGTGCAGG + Intergenic
1021254886 7:18379691-18379713 AACAGAAGAACAAATACTGGGGG - Intronic
1021497166 7:21288731-21288753 CACAGAAAGAAAAATATTGAAGG + Intergenic
1021893285 7:25208835-25208857 CACAAAAAGAAAAATATGGCAGG - Intergenic
1022481043 7:30743355-30743377 CAGGGAAGGACAAATACTGTAGG - Intronic
1022553335 7:31263395-31263417 TACAGAAAGACAAATATCACAGG - Intergenic
1022841418 7:34167765-34167787 CACAGAAGGACAAATCCTCGTGG + Intergenic
1022929910 7:35100455-35100477 TACAGAAAGACAAACTTTGCAGG + Intergenic
1023085946 7:36570256-36570278 CACAGAAGGACGAATACTGCCGG - Intronic
1023181299 7:37486342-37486364 AAAAGAAAACCAAATACTGCAGG - Intergenic
1023314815 7:38924903-38924925 CACAGAAAGACAAATGTCACAGG + Intronic
1023592652 7:41795920-41795942 CACAGAATGAGAAATTCTGGAGG + Intergenic
1023687504 7:42751700-42751722 AACAGAAAGTCAAATATTGTAGG + Intergenic
1023772509 7:43571132-43571154 CACTGAAGGACAAATAATTCTGG + Intergenic
1023811107 7:43912807-43912829 CACAGAAAAACAAAAGCTGAGGG - Intronic
1024437030 7:49369283-49369305 TACAGGAAGATAAGTACTGCAGG - Intergenic
1024615770 7:51110352-51110374 CACAGAAGGAGAAATAATGCAGG - Intronic
1025871955 7:65442949-65442971 CACAGAATGACAATTACTGGTGG - Intergenic
1026209575 7:68291994-68292016 AACAGTAAACCAAATACTGCAGG + Intergenic
1026213401 7:68326896-68326918 GACAGAAAACCAAATACTGCAGG + Intergenic
1026375637 7:69747706-69747728 CACACAATGACAAAAACTGTGGG - Intronic
1027181296 7:75941351-75941373 CACAGCTAGAGAAATACTTCCGG - Intronic
1027446564 7:78280280-78280302 CAAAGAAAGACAAATTGTGGGGG + Intronic
1027481594 7:78704901-78704923 AACAGAAAAACAAATACTGCAGG + Intronic
1027642112 7:80748904-80748926 TACAGAAAGACAAAGACAGGAGG - Exonic
1028151878 7:87383354-87383376 AATAGAAAGACAAATACTGCAGG - Intronic
1028334174 7:89630458-89630480 AAGAGAAAGTCAAATACTGCAGG + Intergenic
1028337761 7:89678746-89678768 AACAGAAAACCAAATACTGCAGG + Intergenic
1028669190 7:93381773-93381795 AACAAAAAAACAAACACTGCAGG + Intergenic
1029825804 7:103192903-103192925 TACAGAAAGACAAACTTTGCAGG + Intergenic
1029879283 7:103790083-103790105 AACAGAAAACCAAATACTGCAGG + Intronic
1029963900 7:104718055-104718077 CACAGAAGGACAAACACTTCAGG + Intronic
1030768314 7:113440167-113440189 CTCAGAAAAACAAATGCTGAGGG - Intergenic
1031123211 7:117744426-117744448 CACAGAAAGACAAACATCACAGG - Intronic
1031209261 7:118801461-118801483 AACAAAAAATCAAATACTGCAGG - Intergenic
1031464689 7:122093986-122094008 AACAGAAAACCAAATACTGCAGG + Intronic
1031792822 7:126131912-126131934 CACAGAAAGACACATATTGCAGG + Intergenic
1032260871 7:130335802-130335824 CTCAGACAGACAAATACTGAGGG + Intergenic
1032327805 7:130948316-130948338 CACAAAAGGACAAATACTGTAGG + Intergenic
1032398934 7:131610377-131610399 CAGAGACAGACAAACACTCCTGG + Intergenic
1032476206 7:132213145-132213167 CACAAAATGGCAAATACTGCAGG + Intronic
1032940688 7:136786543-136786565 CACAGAAAGACAAATATTCATGG - Intergenic
1033066665 7:138161887-138161909 CAGAGATAGATAAATACTTCAGG + Intergenic
1033415717 7:141159697-141159719 CACAGTAAGACAAATACTGTAGG + Intronic
1033650473 7:143338941-143338963 CAGAGAAAGATAAGTACTCCGGG + Intronic
1033808606 7:144983224-144983246 CACAGAAACTCAAACACTGTTGG - Intergenic
1033899637 7:146120197-146120219 CATATAAAAGCAAATACTGCTGG + Intronic
1034329686 7:150271427-150271449 AACAGAAAACCAAACACTGCAGG - Intronic
1035567875 8:653766-653788 CACAGAAGGACGAATCCCGCAGG + Intronic
1035567906 8:653939-653961 CACAGAAGGACAAATCCCGCAGG + Intronic
1035992144 8:4504226-4504248 TACAGAAAGTCAAATACCGTAGG + Intronic
1036775653 8:11611089-11611111 CAGAGAAAGACAAATATTGCAGG + Intergenic
1037589855 8:20303610-20303632 CACAGACAGACAAAGACCGACGG + Intronic
1037622400 8:20576317-20576339 CACAGAAGGACAAATACTGTAGG - Intergenic
1037721003 8:21443959-21443981 AAAAGAAAGAAAAAAACTGCAGG - Intergenic
1038027648 8:23606492-23606514 CACAGAAATGCAAAGACTGTTGG - Intergenic
1038173190 8:25157316-25157338 AACAGAAAATCAAATACCGCAGG - Intergenic
1039513203 8:38108209-38108231 AAAAGAAAGAAAAATACTGAAGG + Intronic
1040408984 8:47135564-47135586 CACAGAAAGACAGATACTGCAGG - Intergenic
1041146283 8:54879913-54879935 CACAGAATCACCAAAACTGCTGG - Intergenic
1041623953 8:60003810-60003832 CAGAGAAACACAAAAACTTCAGG + Intergenic
1041722903 8:60992437-60992459 CAAAGAAAGAGAAAGACTGCTGG + Intergenic
1041741448 8:61161546-61161568 CATAGAAAGACAAATACTACAGG + Intronic
1041924811 8:63225719-63225741 CACAGACATATAAACACTGCTGG + Intergenic
1041983436 8:63891037-63891059 CACAGACAGACAAATCTTGATGG - Intergenic
1042233746 8:66586937-66586959 CAGAGAAAGATAAACACTGTAGG + Intronic
1042423681 8:68621238-68621260 CACACACACACAAAGACTGCTGG - Intronic
1043360165 8:79462640-79462662 CAAAGAAACATGAATACTGCTGG + Intergenic
1043367091 8:79545119-79545141 CCCAGAAAAACAAATGCTGAGGG + Intergenic
1043991187 8:86757128-86757150 CACAAAAAAACAAATTCTGGAGG - Intergenic
1044201339 8:89441995-89442017 AACAGAAAAGCAAATATTGCAGG + Intergenic
1044458758 8:92419845-92419867 AACAGAAAACCAAATACTGCAGG - Intergenic
1044680739 8:94774932-94774954 CACAAAAAGATAAACACTACAGG - Intronic
1045521751 8:102909062-102909084 CACAGAAAGAAAAATATTATAGG + Intronic
1046140138 8:110080856-110080878 TACAGAAAGACAAATACTGAAGG + Intergenic
1046181886 8:110660350-110660372 AACACAAAGTCAAATACTGCAGG + Intergenic
1046500552 8:115070874-115070896 CAGAAAAAGAGCAATACTGCGGG - Intergenic
1046859094 8:119070371-119070393 CATAGAAAGAAAAATAATGATGG - Intronic
1047001172 8:120574113-120574135 CACACAAGGACAAACACTACAGG + Intronic
1047057787 8:121186160-121186182 CACCAAAAGACAAATACTACAGG + Intergenic
1047297703 8:123585976-123585998 AAGAGAAAGAGAAAGACTGCTGG - Intergenic
1047874278 8:129118015-129118037 CACAGAAAGAAAAAAACTGTGGG - Intergenic
1048035722 8:130675512-130675534 CAAAGCAAATCAAATACTGCTGG + Intergenic
1048108255 8:131436852-131436874 CACAGAAAGACAAATTTTGCAGG + Intergenic
1048495800 8:134934967-134934989 CATAGAAGGATAAATACTACTGG - Intergenic
1048716083 8:137271933-137271955 AACAGAAAACCAAATATTGCAGG + Intergenic
1048787793 8:138069217-138069239 CACAGCAAAACAATTACTACAGG - Intergenic
1048805107 8:138233030-138233052 CACAGAACAACAAATACTACAGG - Intronic
1049029824 8:140026094-140026116 CACAAAAGGACAAGTACTGTAGG - Intronic
1049568218 8:143354296-143354318 CACAAAAGGAAAAATACTGCAGG + Intronic
1050143822 9:2544541-2544563 GACAGACAACCAAATACTGCGGG + Intergenic
1050268701 9:3918756-3918778 CACAAAAAAACAAAAACTGTGGG + Intronic
1050301120 9:4259945-4259967 TACACAAAGACAAAGTCTGCTGG - Intronic
1050723528 9:8619438-8619460 CACAGAAAGACAAATGCTATGGG - Intronic
1050973713 9:11910616-11910638 TACAGAAAAGCAAATGCTGCAGG - Intergenic
1051276129 9:15400627-15400649 AACAGAAAGACAAATAATCTTGG - Intergenic
1051945391 9:22563383-22563405 CACAGAAGGACAAATATTGCGGG + Intergenic
1052266626 9:26581275-26581297 CACAGAAAGATAAACACTGCAGG + Intergenic
1052659628 9:31411629-31411651 AACAGAAAACCAAATACCGCAGG + Intergenic
1053317311 9:37063015-37063037 CACAAAAGGACAAATACGGTCGG + Intergenic
1053563357 9:39220035-39220057 CACAGAAAGACCAATACTACAGG - Intronic
1053829145 9:42057956-42057978 CACAGAAAGACCAATACTACAGG - Intronic
1054133790 9:61399031-61399053 CACAGAAAGACCAATACTACAGG + Intergenic
1054601415 9:67129491-67129513 CACAGAAAGACCAATACTACAGG + Intergenic
1055144060 9:72911602-72911624 CATAAAAAGACAAATACCGCAGG - Intronic
1055341727 9:75291725-75291747 CACAGAAAGACAAATGTTGCAGG - Intergenic
1055955696 9:81771615-81771637 CACAGAAAAAAAAATAGTGGAGG - Intergenic
1055969425 9:81897063-81897085 AACAGAAATCCAAATGCTGCAGG + Intergenic
1055987834 9:82070199-82070221 CACAGAAAAGCAAATACTGCTGG - Intergenic
1056380818 9:86055689-86055711 CACAGAAGGACAAATGCTGTAGG + Intronic
1057051763 9:91929261-91929283 CACAGAATGACAAAGCCTCCAGG - Intronic
1057191500 9:93090564-93090586 TACAAAAAGACAAATACCGCGGG - Intergenic
1057977450 9:99621169-99621191 CACAGGAAGATAAATACTGCAGG + Intergenic
1058038360 9:100277631-100277653 CACAAAAAGACAAAAACCACTGG + Intronic
1058180836 9:101796467-101796489 CACAAAAAGACAAATAGTTTAGG + Intergenic
1058207180 9:102122724-102122746 AACAGAAAACCAAACACTGCAGG + Intergenic
1058396082 9:104556246-104556268 CACAGAGAGACAACTGTTGCAGG + Intergenic
1058406743 9:104684968-104684990 CACTGCAAGACAAACACTGTAGG + Intergenic
1058664878 9:107303625-107303647 CACAAAAAGACAAATACCATAGG - Intronic
1058856007 9:109062997-109063019 CACTGAAACACAAGTACTGTTGG + Intronic
1058884193 9:109310935-109310957 CACAAATGGACAAATACTGTAGG + Intronic
1058893794 9:109383050-109383072 CATAGAAAGACACATACTGTAGG - Intronic
1059013679 9:110490561-110490583 CACAGAAAGACAAATATCTCAGG - Intronic
1059054033 9:110959896-110959918 CACAGAATGACAAATATCCCAGG + Intronic
1059229942 9:112710872-112710894 TACAGAAAGTAAAATACAGCCGG + Intronic
1059915769 9:119098284-119098306 CACAGAAAGATAAATCCTGCAGG + Intergenic
1060549560 9:124478485-124478507 CACAGATAGGCAAAGACTGGGGG - Exonic
1060703380 9:125779151-125779173 CACAAAAGGACAAATATTGTAGG - Intronic
1061166458 9:128925520-128925542 CACTGAAAGTCACCTACTGCTGG - Intronic
1061294585 9:129670083-129670105 CACAGAACGGCAAATACTGTAGG - Intronic
1062159532 9:135072501-135072523 CACTGACGGACAAGTACTGCAGG - Intergenic
1203422544 Un_GL000195v1:7488-7510 CACAAAAAGAGAAAAGCTGCAGG - Intergenic
1185484784 X:474060-474082 CACAGAAAGATAAACACTGTGGG - Intergenic
1185577997 X:1188785-1188807 AACAGAAAACCAAACACTGCAGG + Intronic
1185879907 X:3731766-3731788 CACGGAAAGACAAATACTGCAGG + Intergenic
1186114421 X:6290332-6290354 TGCAAAAAGACAAATAGTGCAGG + Intergenic
1186433556 X:9524472-9524494 CACAAAAAGACACATAGTGTAGG - Intronic
1186473175 X:9836962-9836984 CACAGAACACCACATACTGCAGG - Intronic
1186735981 X:12464393-12464415 CAAAGAAAAACAAATATTGGTGG - Intronic
1186968660 X:14815909-14815931 AACAGAAAGCCAAATACTTCAGG + Intergenic
1187118962 X:16384629-16384651 AACAGAAAACCAAATACTGCAGG - Intergenic
1187169047 X:16833011-16833033 CACAGAAAAACAACAAGTGCAGG - Intronic
1187178473 X:16918679-16918701 CATAGAAAGACAAATACCGCAGG + Intergenic
1187654898 X:21460789-21460811 CACCTAAAGACAAGCACTGCAGG - Intronic
1187894853 X:23971138-23971160 CACAGAATGATAAATACTTCAGG - Intergenic
1187986817 X:24822649-24822671 TACAGAAAGCCAATTCCTGCAGG + Intronic
1188025894 X:25209130-25209152 AACAGAAAACTAAATACTGCAGG + Intergenic
1188479761 X:30625151-30625173 CAAAGAAAGATAAACATTGCAGG + Intergenic
1188875064 X:35419364-35419386 CGCAAAAAGACAAATACTGTAGG - Intergenic
1188946052 X:36303506-36303528 CACAGAAAGCCAAACGTTGCTGG - Intronic
1188999564 X:36929261-36929283 CCAAGAACCACAAATACTGCAGG + Intergenic
1189028652 X:37427701-37427723 CATAGAAAGACAAATACCACAGG - Intronic
1189370478 X:40424174-40424196 CACAAAAAGACAAATATTGTCGG - Intergenic
1189435044 X:40985070-40985092 AACAGAAAACCAGATACTGCAGG - Intergenic
1189863378 X:45296865-45296887 AACACAAAGAAAAATACTGTAGG + Intergenic
1190219065 X:48499301-48499323 CAAAGAAAGAAAAAGACTTCAGG + Intergenic
1190269190 X:48849336-48849358 CAAAAAAAGACAAATACTGCAGG - Intergenic
1190409683 X:50123971-50123993 AACAGAAAACCAAATACTTCAGG - Intergenic
1190524792 X:51317835-51317857 CAGGGAAATACAAAGACTGCAGG + Intergenic
1190853413 X:54268599-54268621 CACAGCAAGACAGATATTCCAGG - Intronic
1191590136 X:62873709-62873731 CACATAAAGAGAAATACCACAGG - Intergenic
1191603555 X:63037240-63037262 AACAGAAAGTCAAATACTGCAGG - Intergenic
1191971291 X:66819635-66819657 CACAGAAAGACAAACATCACAGG + Intergenic
1192062854 X:67847725-67847747 CACAGAAAGACAAACATCACAGG + Intergenic
1192414493 X:70966478-70966500 CACAGAAAGACAAATATCACAGG + Intergenic
1192572337 X:72216760-72216782 CACAAAAGGACAAATACTTTGGG - Intronic
1192689306 X:73344913-73344935 CACAGAAATACAAGTACTCAAGG + Intergenic
1193192285 X:78585394-78585416 AACAGAAAGACAAATTTTACAGG - Intergenic
1193274017 X:79564447-79564469 AACAGAAAACCAAATACAGCAGG - Intergenic
1193349074 X:80436632-80436654 AACAGAAAGCCAAACACCGCAGG - Intronic
1193722307 X:85001614-85001636 AACAGAAAACCAAATACTGCAGG + Intergenic
1193847460 X:86492084-86492106 GTCACAGAGACAAATACTGCAGG - Intronic
1193962028 X:87938284-87938306 CACAGAAAGAAAAAAACTTAAGG + Intergenic
1194489438 X:94528375-94528397 CATAGAAAGAAAAATACTGCAGG - Intergenic
1194578242 X:95639894-95639916 CACAGAAAAATAAAAACAGCTGG - Intergenic
1194733728 X:97487009-97487031 CACACAAAGACTCATACTGCGGG - Intronic
1195097585 X:101519410-101519432 CACAGAAGGGCAAATACTGTAGG - Intronic
1195396347 X:104414232-104414254 CCCAGAAAAACAAAAGCTGCGGG + Intergenic
1195428245 X:104760039-104760061 CACAGAAAGACAAACTTAGCAGG - Intronic
1195632577 X:107073865-107073887 CACAGAAAGTTAAACACTGCAGG + Intronic
1196106872 X:111905932-111905954 GAAAGAAAGAAAAATACTGAAGG + Intronic
1196142633 X:112281232-112281254 CACAGAAAGACAAATGCCACAGG - Intergenic
1197841362 X:130750772-130750794 CAGAGAAAGACAGATACAGAGGG - Intronic
1198015466 X:132605987-132606009 AACAGAAAACCAAACACTGCAGG + Intergenic
1198019145 X:132641441-132641463 AACAGAAAACCAAATATTGCTGG - Intronic
1198234491 X:134724427-134724449 CACAGAAAGAAAAATGCACCTGG - Intronic
1199010361 X:142750970-142750992 CACAGAAAGACAAATACTGCAGG - Intergenic
1199257828 X:145737048-145737070 CACAGAAAAACAAATATTGTAGG + Intergenic
1199634190 X:149800107-149800129 CATGAAAAGACAAATACTGTAGG - Intergenic
1199739780 X:150723825-150723847 AACAGAAAACCAAATACTGTAGG - Intronic
1199808843 X:151329079-151329101 CACAAAAGGACAAATACTGTAGG + Intergenic
1199978762 X:152909405-152909427 CACAGAAAGCAAAGTACTCCAGG - Intergenic
1200006099 X:153085364-153085386 CACAAAAGGACAAATAGTGTAGG - Intergenic
1200082258 X:153583545-153583567 CACAGAAGGGCAAATACTGTAGG - Intergenic
1200223870 X:154405888-154405910 CACAAAAAGACAAATACTGTAGG - Intronic
1200674855 Y:6137510-6137532 CTCAGACAGACAAATACTAAGGG + Intergenic
1200751064 Y:6944651-6944673 CACAAAAAGATAAATACTGCAGG - Intronic
1201239134 Y:11941463-11941485 AACAAAAAGACAAATAGTGGTGG + Intergenic
1201335601 Y:12877796-12877818 CACAAAAAGACAAATACTGCAGG + Intergenic