ID: 955914844

View in Genome Browser
Species Human (GRCh38)
Location 3:63896550-63896572
Sequence CTGAAGAAACAGATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955914844_955914849 27 Left 955914844 3:63896550-63896572 CCTTCCTCAATCTGTTTCTTCAG 0: 1
1: 0
2: 4
3: 56
4: 468
Right 955914849 3:63896600-63896622 TCTTTTGAACACAGGGTTATTGG 0: 1
1: 0
2: 0
3: 25
4: 233
955914844_955914848 20 Left 955914844 3:63896550-63896572 CCTTCCTCAATCTGTTTCTTCAG 0: 1
1: 0
2: 4
3: 56
4: 468
Right 955914848 3:63896593-63896615 TAACAGCTCTTTTGAACACAGGG 0: 1
1: 0
2: 1
3: 12
4: 168
955914844_955914847 19 Left 955914844 3:63896550-63896572 CCTTCCTCAATCTGTTTCTTCAG 0: 1
1: 0
2: 4
3: 56
4: 468
Right 955914847 3:63896592-63896614 GTAACAGCTCTTTTGAACACAGG 0: 1
1: 0
2: 0
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955914844 Original CRISPR CTGAAGAAACAGATTGAGGA AGG (reversed) Intronic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
901013823 1:6216313-6216335 CTGCAGAAATAAATTGAGGCTGG + Intronic
901912645 1:12472999-12473021 GTAAAGAAACAGGTTGTGGAAGG + Intronic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903257605 1:22113457-22113479 GTGAGGAACCAAATTGAGGATGG + Intergenic
903259465 1:22123464-22123486 CTGAAGGAAGAGATTCTGGAAGG + Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
904633743 1:31863608-31863630 CTGAAAAATAAGATTGAGAAGGG + Intergenic
907022595 1:51083008-51083030 CTGATGAAAGAAATTGAAGAAGG - Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909781679 1:79556697-79556719 GGAAAGAAACATATTGAGGAAGG + Intergenic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
911441835 1:97936748-97936770 TTTAAGAAAGAAATTGAGGAGGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912448045 1:109752193-109752215 CCTAAGAAACAGAGTCAGGATGG + Exonic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
913423579 1:118701094-118701116 CTGATGAAAGAAATTGAAGAGGG - Intergenic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916417630 1:164607476-164607498 CTGAAGAAAGCTACTGAGGAAGG + Intronic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918610097 1:186479745-186479767 ATGAAGAAACAGATTAAGAGAGG + Intergenic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920545181 1:206810505-206810527 ATTAAGAAACACATTGACGAAGG + Intronic
920622921 1:207565990-207566012 TTGAAGAATCACATTGAGGGAGG - Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
921256401 1:213344118-213344140 CTTAAGAAAAAAATTGAAGAAGG + Intergenic
921410340 1:214829732-214829754 CTTATAAAAGAGATTGAGGAGGG - Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921681623 1:218039818-218039840 CTTAGGAATCAGATTGAGGTGGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922852394 1:228744620-228744642 CCGAAGAGACAGCTTGAGTATGG - Exonic
923047205 1:230364102-230364124 GTGAACAAAGAGATTGAGCAAGG - Intronic
923203446 1:231734370-231734392 CTGAAGAAAGAGCTTGATTATGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923367867 1:233280827-233280849 CAGAAGAAACAGATTTACAAAGG - Intronic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
924244368 1:242068196-242068218 CTGAATAAACCTATTGAGCAAGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1066007554 10:31159458-31159480 CTTAAGAAAGAGATGGAGGCAGG + Intergenic
1066187275 10:33022381-33022403 CTGAAGTATCATATTGTGGAAGG + Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068610876 10:59058562-59058584 CTGAAGAATCAGTTTTAGGACGG + Intergenic
1068885339 10:62091867-62091889 CTGAAGCAAGAAATTCAGGAGGG + Exonic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1071481159 10:86066078-86066100 CTGAAAAGACAGATTAAAGAGGG + Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072757873 10:98032321-98032343 CTGAAGAAACAGGTTGACATTGG - Intergenic
1073061973 10:100738604-100738626 TTGAAGAAACTGATGGAGGGAGG - Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073994391 10:109299144-109299166 CTGAAGGAACAGAGTGATGTTGG - Intergenic
1074212038 10:111344141-111344163 TAGAAGAAAAAGATGGAGGAAGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1077105364 11:839938-839960 CTGAAGAGCCAGATTTAGGCCGG - Exonic
1077622057 11:3734507-3734529 CAGAAGAAACAAATTTAGGGAGG + Intronic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078127211 11:8579177-8579199 CTGAAGAATCAGTTAGAGTAGGG + Intronic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081346927 11:41999365-41999387 CTGAAGAAGCAGCTTCAGTATGG + Intergenic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081722877 11:45302958-45302980 AGGAAGAAACAGATGGAGAAAGG + Intergenic
1082131640 11:48497010-48497032 CTGAAGAATCTTAGTGAGGAAGG + Intergenic
1083601523 11:63951639-63951661 CTGATCAAACAGATTGAGGCAGG - Intronic
1085925752 11:81018546-81018568 TTGAAGAAAGGGATTAAGGAAGG + Intergenic
1085998116 11:81947157-81947179 GTGAAAATCCAGATTGAGGATGG - Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086899066 11:92345837-92345859 TTGAGGAAACAGATTGAGACAGG - Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1089465242 11:118680733-118680755 CTTAAGAAGCAGATTCAGGCTGG + Intergenic
1089852493 11:121512450-121512472 CTGAATAATCTCATTGAGGAAGG - Intronic
1090235240 11:125142094-125142116 CTGAACATAAAGCTTGAGGAAGG + Intergenic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091064123 11:132492555-132492577 AGGAAGAAACAGGTTGAGAAGGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092803495 12:12196355-12196377 CTGATGAAAGAAATTGAAGAGGG - Intronic
1093602199 12:21041434-21041456 TTGATGAAAGAAATTGAGGAGGG - Intronic
1093909395 12:24728591-24728613 CTGTAGAGAGATATTGAGGATGG - Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095572443 12:43698922-43698944 CTGATGAAAGAAATTGAAGAGGG - Intergenic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096415998 12:51414081-51414103 CTGATGAAAGAAATTGAAGAGGG - Intronic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097318792 12:58202629-58202651 TTGAACAAAAAGATGGAGGAAGG - Intergenic
1097935263 12:65242230-65242252 CTGAAGAAAAAGTCTGAGGTAGG - Intronic
1098292392 12:68968889-68968911 CTAAAGCTCCAGATTGAGGATGG - Intronic
1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG + Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100208716 12:92378996-92379018 ATGAAGAAAAATATTCAGGAAGG + Intergenic
1101538882 12:105646247-105646269 CTGATGAAACAAAATGAGGCTGG + Intergenic
1101582736 12:106058101-106058123 GTGAAGAAACAGATTGAAAGAGG - Intergenic
1101842906 12:108340701-108340723 CTGAATTAAAGGATTGAGGATGG - Intergenic
1101953970 12:109197599-109197621 CTGAACAAACAGATAGTGGCAGG + Intronic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102662980 12:114545839-114545861 CTCAAAAAAAAAATTGAGGAGGG - Intergenic
1104521042 12:129475410-129475432 TTGAGGAAACAGTTTGTGGAAGG - Intronic
1105296612 13:19092059-19092081 CTGAAGGAGGAGCTTGAGGAAGG - Intergenic
1105326950 13:19379338-19379360 CTGATGAAATAGTTTGAAGATGG - Intergenic
1105864698 13:24449017-24449039 CTGATGAAACAGTTTGAAGATGG + Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1107022347 13:35764736-35764758 CTGATGAAACATATTGAGAGAGG + Intergenic
1107118679 13:36775170-36775192 CTGACCAAACAGATAGAAGACGG - Intergenic
1107349579 13:39500099-39500121 TTGAAGAAACATACTGAGGCAGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG + Intergenic
1107736549 13:43405141-43405163 CTGAAGAGACAGTTTCAGGCAGG + Intronic
1108025828 13:46176354-46176376 CTGAAAAAACATTTTCAGGATGG + Intronic
1109096528 13:58124989-58125011 CTGATGAAAGACATTGAAGAAGG + Intergenic
1109461408 13:62663645-62663667 CTCAAAAAAGAGACTGAGGATGG + Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1111108316 13:83674482-83674504 CGGAAGAAAAGAATTGAGGAAGG - Intergenic
1113137244 13:107105460-107105482 CTGATGAAAAAAATTGAAGAGGG - Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1114745414 14:25140853-25140875 CTGAAGAAACTTCTGGAGGAAGG - Intergenic
1115888711 14:38003635-38003657 CTGATGACCCAGATTGTGGAAGG - Intronic
1116182766 14:41556177-41556199 CTTACTAAACAGATTGGGGATGG + Intergenic
1116930357 14:50684521-50684543 CTGATGAAAGAAATTGAAGAGGG - Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120730920 14:88000525-88000547 CTGATGAAAGAAATTGAAGAAGG - Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124451200 15:29792769-29792791 CTGATGAAAGATATTGAAGACGG - Intronic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125007558 15:34835473-34835495 CTGATGAAAGAAATTGAAGAGGG + Intergenic
1125146061 15:36470011-36470033 TTGAAGAAAAAGATTGAAAAGGG - Intergenic
1125622915 15:41080557-41080579 TTTAATAAACAGATTGAGGCCGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1130763807 15:86849848-86849870 CTTTAGAAACAGAGTGAGTAAGG + Intronic
1133129637 16:3668878-3668900 CTCAGGAAACACATTCAGGATGG + Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1133962133 16:10503687-10503709 TTGAGGAAACTGATTTAGGAAGG - Intergenic
1134288656 16:12884803-12884825 TTGATGAAACAAATTAAGGAAGG - Intergenic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1137497226 16:48979891-48979913 CTGAAGAACAAGATTGAGCAGGG + Intergenic
1137543192 16:49378472-49378494 CTTAGGAAAGAGATTCAGGAAGG + Exonic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1139193917 16:64896505-64896527 TTTAAGAAACAGTTTCAGGATGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG + Intergenic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1141070348 16:80948778-80948800 GTGAAGGAAGAGATTGTGGAAGG + Intergenic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1143520554 17:7441923-7441945 CTCAAGGGACAAATTGAGGAAGG - Intronic
1144197802 17:12912121-12912143 TGGAAGAAACAGATTGTGTAGGG + Intronic
1144445779 17:15326755-15326777 CTGAAAAAAGAGATTGGGAAGGG + Intronic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1146907749 17:36628972-36628994 CCCATGAAACAGATTGAGCAAGG + Intergenic
1147443445 17:40461217-40461239 CTGAAGACAGAGGTTGAGGTTGG + Intergenic
1149597177 17:57871173-57871195 GTGAAAAAACAGATTGTGGGAGG - Intronic
1149614122 17:57983871-57983893 CAGAAAACTCAGATTGAGGAAGG + Intronic
1150022932 17:61638723-61638745 TTGATGAAAGAAATTGAGGAGGG + Intergenic
1150051262 17:61965641-61965663 CTGAAGAAACATATTTAAAATGG + Intronic
1151298278 17:73201959-73201981 CTGAAGGAACTGATTGAGGTTGG - Intronic
1151510370 17:74555263-74555285 CTCAGGAAACAGAATGAGAAGGG - Intergenic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153656260 18:7285243-7285265 ATGAAGAAATAGATTGTGGGAGG - Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156281436 18:35643084-35643106 CAGAAGAAACCTTTTGAGGAGGG + Intronic
1156585197 18:38424283-38424305 TTCAAGAAAGAGATGGAGGAGGG - Intergenic
1156794020 18:41018489-41018511 CTGATGAAAGAAATTGAAGAGGG + Intergenic
1157507219 18:48236624-48236646 CTAAAGCAAAAGATTGAGGTGGG + Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158799699 18:60891949-60891971 CTAAAGAAACAGAATAAGCAGGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162034972 19:7933760-7933782 CTCAAGAAACGGACTCAGGAGGG + Intronic
1162422362 19:10573089-10573111 CTGCAGAGAAAGAATGAGGAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
925898713 2:8493534-8493556 CTGAACAAACAGGCTGATGAAGG + Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
927261698 2:21098145-21098167 CTAAAGAAACAGATTGCTCAGGG - Intergenic
927475915 2:23414119-23414141 CAGAAGAAAGAGGCTGAGGAGGG + Intronic
927676532 2:25110422-25110444 CTGAAGAAGCTGATTTGGGAGGG - Intronic
928142194 2:28739490-28739512 CTGATGAAACATTTTGAGAAGGG + Intergenic
928350117 2:30543861-30543883 CTAAAAACACAGATTGATGAGGG - Intronic
928781633 2:34829330-34829352 CTGATGAAAAAAATTGAAGAGGG - Intergenic
929356662 2:41033078-41033100 CTGAAAAGACAGCTTTAGGAGGG - Intergenic
931268918 2:60684816-60684838 CTGAAGAAACAGTTTAAAAATGG + Intergenic
932679715 2:73814523-73814545 CTAAAGTAATAGATTAAGGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936946475 2:117935517-117935539 CAGATGGAACAGATTGTGGAAGG - Exonic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
939445349 2:142303135-142303157 CAGAAGAAAGAAATTCAGGAGGG - Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942163263 2:173214973-173214995 CCTGAGAGACAGATTGAGGAAGG + Intronic
942497159 2:176551880-176551902 TAGAAGAAAAAGATGGAGGAAGG + Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942831532 2:180242181-180242203 CTAAAGAAACACATTGAAGGTGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943147814 2:184067252-184067274 CTGAAGAAACTATTTGAGTATGG + Intergenic
943678358 2:190740583-190740605 TTTAAGTAACAAATTGAGGATGG - Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168918799 20:1513862-1513884 AGGAAGCAATAGATTGAGGATGG + Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170276294 20:14594180-14594202 GTGAAGAACCAGGTTGAAGAGGG - Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1170509699 20:17063999-17064021 CTAAAGACACAAATTGAAGAAGG - Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171515858 20:25734459-25734481 CTAAATAAACAGAGTGACGAGGG + Intergenic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1175474885 20:59265186-59265208 CTGAAGGGACAGATTGCTGAAGG + Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1183798399 22:40140470-40140492 TGGAAGAAACATATTGAAGATGG + Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
950279943 3:11698201-11698223 ATGAAGAAACAGCTGGAGGCTGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951152784 3:19312010-19312032 CGGAAGAAAGAGTTTGAGAAAGG - Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
955565749 3:60243370-60243392 CTGAAGAAACCAATTGAGTGTGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
957749583 3:84395787-84395809 CTGAAAAATCAGGTTGAGAACGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958255599 3:91321304-91321326 CTGTAGGAACATGTTGAGGAGGG - Intergenic
958581829 3:96035976-96035998 CTGATGAAACAAATTAAAGAAGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
960013916 3:112863868-112863890 CTGATGAAAAAAATTGAAGAGGG - Intergenic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
961083126 3:124043423-124043445 CAGAAGTAATAGATTGAGGAAGG + Intergenic
961687740 3:128646359-128646381 GTGAAGAAACAGTTTTAGGCTGG - Intronic
964592366 3:158378893-158378915 GTGAATAAACAGATTTTGGAGGG - Intronic
965873445 3:173287846-173287868 GTTAAAAAACAAATTGAGGAGGG - Intergenic
966054174 3:175662151-175662173 CTGATGAAAGAAATTGAAGAGGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
967730307 3:192900985-192901007 TTGAAGAAACTGATGAAGGATGG + Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
970388662 4:15583989-15584011 CTGATGAAAGAAATTGAGGAAGG + Intronic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972037517 4:34545113-34545135 CTTAAGAAATATATTGGGGAAGG + Intergenic
972371332 4:38426315-38426337 CTCAAGAAAGAGATTGAGCATGG - Intergenic
972541238 4:40041295-40041317 CAGAAGAAAAAAATTGAGGCTGG + Intergenic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974339436 4:60596016-60596038 CTGAAGGAAAAGATTGGGGAAGG - Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
975215015 4:71743063-71743085 TTGAAGAAAAAGATTGATCAAGG + Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976050180 4:81002488-81002510 CTCAAGAAAAACCTTGAGGATGG + Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
979027091 4:115591268-115591290 CTGAAGAAACAGAGTGTAGTGGG - Intergenic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980587551 4:134836494-134836516 CTGATGAAATAAATTGAAGAAGG - Intergenic
980706231 4:136499342-136499364 CTGAAGTAAGAGATTCAAGAAGG - Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
982465271 4:155722780-155722802 ATGAAGAAACAGTTTGGGTAAGG + Intronic
983621510 4:169766158-169766180 CAGAAGAAACAGATTTGGGAAGG + Intergenic
983966450 4:173818817-173818839 CAGAACAAAAAGACTGAGGAAGG + Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985220039 4:187694859-187694881 TTGAACAAAAAGATTGAGCAAGG + Intergenic
985360609 4:189171739-189171761 CTGAAGAAACAGCTCCAGCATGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990125651 5:52514620-52514642 CTGATGAAAGAAATTGAAGAAGG + Intergenic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
991336913 5:65559097-65559119 ATGAATAAAGATATTGAGGAGGG - Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992762667 5:79964863-79964885 CTCAAGGAAGAGATTGAGGCTGG - Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994036601 5:95208922-95208944 GAGAAGAAACAGATTAAAGAAGG - Intronic
994330409 5:98498476-98498498 GAGATGAAACATATTGAGGAAGG + Intergenic
994437193 5:99752072-99752094 ATGAAGAAAGAAATTGAAGAGGG - Intergenic
994806781 5:104458494-104458516 CTCAAGAAACAGATAAATGATGG - Intergenic
995662275 5:114498689-114498711 ATGAAGAAAATTATTGAGGAAGG - Intergenic
996026584 5:118653114-118653136 CTGAAAGAACAGTTTGGGGAAGG + Intergenic
996364616 5:122687918-122687940 CTGATGAAAGAAATTGAAGAAGG + Intergenic
996816982 5:127584979-127585001 CAGAAGAAATTGATTTAGGAAGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997300219 5:132798208-132798230 GTGCAGAAACAGGTTGAAGAGGG - Intronic
997310681 5:132878457-132878479 CTGAGGACACCTATTGAGGAGGG + Exonic
998002275 5:138634676-138634698 CTTAAGAAACAGTTTGAGGCCGG + Intronic
998102671 5:139447221-139447243 CTGTAGAAACCGAGTGAGCAGGG - Intergenic
999292941 5:150439308-150439330 CTGCACCAAGAGATTGAGGATGG + Intergenic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000760383 5:165216249-165216271 CTGAGGAAACAGAGTGAAGCAGG + Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1003974707 6:11331359-11331381 CTGAAGCAACAGGGTGAGGCGGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004458100 6:15810253-15810275 ATCACTAAACAGATTGAGGAAGG + Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1006738348 6:36291130-36291152 CGGAAGCAAGATATTGAGGAAGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007166963 6:39835608-39835630 ATGAACAAACATATGGAGGAAGG + Intronic
1007815222 6:44518289-44518311 CTGATGAAAGAAATTGAAGAGGG - Intergenic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1008368768 6:50711105-50711127 CTAAAGAAACTCATTGAGGCAGG - Intergenic
1008417327 6:51257293-51257315 CTGAAGAAATAGATAAAGGGAGG + Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1008497631 6:52149255-52149277 GTCAAGAAAGAGTTTGAGGATGG + Intergenic
1008639112 6:53443408-53443430 ATTAAGACACAGATTGAGGCTGG + Intergenic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1008726019 6:54420553-54420575 ATGAAGAAAGTTATTGAGGAAGG - Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1012744682 6:103070599-103070621 CTGATGAAAAAAATTGAAGAGGG + Intergenic
1013673753 6:112434348-112434370 CGGGGGAAACATATTGAGGAAGG - Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014186505 6:118440421-118440443 CTGATGAAAGAAATTGAAGAGGG - Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017675533 6:156809986-156810008 CTGAGGAATCAGATTCAGGAGGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017996243 6:159534036-159534058 CTCAGCAAACAGAGTGAGGATGG + Intergenic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1020949284 7:14654370-14654392 CTGATGAAAAAAATTGAAGAGGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021550580 7:21867252-21867274 CTGAAGAAACACAATAGGGAAGG - Intronic
1022036014 7:26535328-26535350 CTGAGGAAACACATAGAGGCAGG + Exonic
1022479764 7:30735070-30735092 TGGAAGAAACAGATTGTGCAGGG - Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023224099 7:37951038-37951060 CTAAAGAAACATTTTGAGCAAGG + Exonic
1023725467 7:43138717-43138739 CTCAAGCAACAGTTTTAGGACGG + Intronic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024136715 7:46416165-46416187 CTCTAGAAACAACTTGAGGAGGG - Intergenic
1024862106 7:53856762-53856784 CTGAAGAAATACAATGAGGCTGG - Intergenic
1025800433 7:64781785-64781807 CTGAAGAAAATAATGGAGGATGG + Intergenic
1026384824 7:69836023-69836045 CTGAAGAAACAGATAAATGGTGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1028105566 7:86873736-86873758 TTGATGAAAAAAATTGAGGATGG + Intergenic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031550397 7:123104651-123104673 CTGAAGAAAGAGTTTTAGCAAGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1035815615 8:2536913-2536935 TTGATGAAAGAAATTGAGGAGGG - Intergenic
1035906662 8:3518238-3518260 TTGAAGAAACATATTTATGAAGG - Intronic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1038272809 8:26089675-26089697 CTGAAGACGTAGATTCAGGAAGG - Intergenic
1038378463 8:27068241-27068263 CTGATGAAAGAAATTGAAGAGGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040069256 8:43176706-43176728 CTGATGAAAGAAATTGAAGAGGG - Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1041411890 8:57565172-57565194 CTGAAGAAACTGCTTGATGGTGG + Intergenic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1041863101 8:62536501-62536523 CTGTAGAAACTGAATAAGGAAGG + Intronic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042995252 8:74691155-74691177 CTGAACAAAGTGATTGAGAAAGG + Intronic
1043031148 8:75135071-75135093 TGAAGGAAACAGATTGAGGAGGG - Intergenic
1043035964 8:75199689-75199711 CTGAAGAAGGAAATTGAAGAGGG - Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044407713 8:91848533-91848555 CTGATGAAAGAAATTGAAGAAGG + Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044913230 8:97084380-97084402 CTCAAGAAAAAGATGGGGGAGGG - Intronic
1045566818 8:103325669-103325691 CTGAAGCTAAAGCTTGAGGAAGG - Intronic
1046536848 8:115525561-115525583 CTAAATAATCAGATTGAGAATGG - Intronic
1046747605 8:117892924-117892946 CAGAAGCAACATATTGGGGAGGG + Intronic
1047078600 8:121434056-121434078 CTGAGGTAACAGATGGAGTAGGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047628472 8:126680664-126680686 CTAAAGAAACAGAATGAAGTGGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1048145054 8:131833587-131833609 CTAAAGAAACATCTTGAGAATGG - Intergenic
1048285083 8:133135254-133135276 CTGAAGCAAGACAATGAGGATGG + Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1050451518 9:5786593-5786615 CTGAAGAAACAGCTTGACACAGG + Exonic
1050943924 9:11494332-11494354 CTGAAGAAACTCATTGATTATGG - Intergenic
1051224350 9:14883243-14883265 CTGAAGCAACACAGTTAGGAGGG + Intronic
1051401110 9:16683755-16683777 CAGAAGAAGCACATTTAGGAAGG + Intronic
1051628035 9:19116921-19116943 CTGAAGAAACATATTAGGTAGGG + Intronic
1051798889 9:20908628-20908650 CTGAAGATAAAAATTGAGTAAGG - Intronic
1051845586 9:21448191-21448213 CTGAAGAAAAAGCTGGTGGAAGG - Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1052519773 9:29531586-29531608 GTGAAGAAACAAATTTGGGAAGG - Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056618587 9:88190948-88190970 GTGAAGAAACGCTTTGAGGATGG - Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060835245 9:126750938-126750960 GTGAACAACCAAATTGAGGAAGG + Intergenic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1186554344 X:10541802-10541824 ATTAAGAAACAAATAGAGGAAGG + Intronic
1186986842 X:15026242-15026264 CTGAAGAGACATTTTCAGGAGGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189273593 X:39768949-39768971 CTGACCAAGCAGATTCAGGAGGG + Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1191650719 X:63534867-63534889 CTGATGAAAGAAATTGAAGAGGG + Intergenic
1192252656 X:69425630-69425652 ATGAAGATACAGATTGGAGAGGG - Intergenic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192952495 X:76032133-76032155 CTGACGATACACCTTGAGGAGGG + Intergenic
1193282609 X:79671580-79671602 CTGATAAAAGAAATTGAGGAGGG - Intergenic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1194049645 X:89053233-89053255 CAGAAGACACATATTGAGGCTGG - Intergenic
1194686368 X:96922806-96922828 CAGAAGAAACAGATATAGGTGGG - Intronic
1196894315 X:120319954-120319976 CTGAAGAATGACATTGGGGAAGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1202129802 Y:21599286-21599308 GTGAAGATACAGATTGGTGAAGG - Intergenic
1202604863 Y:26630264-26630286 CTGATGAAATAGTTTGAAGATGG + Intergenic