ID: 955916276

View in Genome Browser
Species Human (GRCh38)
Location 3:63911941-63911963
Sequence CGGCCGGCCGGCTCCTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955916270_955916276 -6 Left 955916270 3:63911924-63911946 CCGCGCTGCCCTGGGGCCGGCCG 0: 1
1: 0
2: 3
3: 28
4: 278
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916267_955916276 0 Left 955916267 3:63911918-63911940 CCTCTCCCGCGCTGCCCTGGGGC 0: 1
1: 0
2: 1
3: 37
4: 389
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916263_955916276 4 Left 955916263 3:63911914-63911936 CCAGCCTCTCCCGCGCTGCCCTG 0: 1
1: 0
2: 7
3: 58
4: 582
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916261_955916276 11 Left 955916261 3:63911907-63911929 CCCTGCACCAGCCTCTCCCGCGC 0: 1
1: 0
2: 0
3: 28
4: 307
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916258_955916276 27 Left 955916258 3:63911891-63911913 CCGAGGGCAAAGTGCCCCCTGCA 0: 1
1: 0
2: 0
3: 16
4: 179
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916262_955916276 10 Left 955916262 3:63911908-63911930 CCTGCACCAGCCTCTCCCGCGCT 0: 1
1: 0
2: 0
3: 23
4: 313
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916259_955916276 13 Left 955916259 3:63911905-63911927 CCCCCTGCACCAGCCTCTCCCGC 0: 1
1: 0
2: 4
3: 91
4: 1012
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916260_955916276 12 Left 955916260 3:63911906-63911928 CCCCTGCACCAGCCTCTCCCGCG 0: 1
1: 0
2: 1
3: 25
4: 405
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70
955916269_955916276 -5 Left 955916269 3:63911923-63911945 CCCGCGCTGCCCTGGGGCCGGCC 0: 1
1: 0
2: 3
3: 41
4: 457
Right 955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955916276 Original CRISPR CGGCCGGCCGGCTCCTCCAT AGG Intronic
900321099 1:2084504-2084526 CGGCCGGCCGGCTCACAGATGGG + Intronic
901022249 1:6261270-6261292 CGGCCGGCCCGAGCCTCCCTGGG + Intergenic
906214384 1:44030528-44030550 CGGCCGCCCGGCCCCGCCCTAGG + Intronic
907140681 1:52182142-52182164 CGCCCGGCCAGCTGCCCCATCGG + Intronic
908609880 1:65845978-65846000 TGGCTGGCCGCCTCCTCCGTGGG + Intronic
910289051 1:85582161-85582183 AGGCCGTCCTGGTCCTCCATGGG - Exonic
915409455 1:155688957-155688979 CGGCTCGCCTCCTCCTCCATGGG + Intronic
918388873 1:184037482-184037504 CGGCCGGCCGGCTCACACACTGG + Exonic
922744893 1:228038200-228038222 CGGCCGCCTGGCTCCTCCTGGGG + Intronic
1065099582 10:22320782-22320804 CGGCCGCCCGCCTCCTCCCGGGG - Intronic
1069837611 10:71319224-71319246 CGGCAGGCGGGCTCCTCCCCCGG - Intergenic
1072591818 10:96833336-96833358 CGGCCGCCCGGCCCCTCCCGGGG - Intronic
1073077049 10:100830637-100830659 CGGTCGGCGGGTTCCTGCATAGG + Intergenic
1073514469 10:104064509-104064531 CTGCCCGCGGGGTCCTCCATGGG - Exonic
1089253575 11:117181744-117181766 CAGCCGGCCTGCCCCTCCAGAGG - Intronic
1089659416 11:119976209-119976231 AGGCCGGGGGGCTCCTCCAGGGG + Intergenic
1092002495 12:5044030-5044052 CGGTCGGCCGGCCCCTCTCTGGG - Exonic
1101815204 12:108140825-108140847 GGGCTGGCCGGCTGCTCCCTGGG - Intronic
1109741519 13:66561160-66561182 CGGCCGGCTGGCCCCGCCACCGG + Intronic
1112913736 13:104521957-104521979 CGGTCAGGCGCCTCCTCCATAGG + Intergenic
1113707790 13:112445569-112445591 CCGCCTGCCGCCCCCTCCATGGG - Intergenic
1113778778 13:112963859-112963881 AGGCAGGGCGGCTCCTCCACTGG + Intronic
1115398217 14:32933223-32933245 CGGCGGGCCGGCTGCGCCCTAGG + Intergenic
1119478124 14:74942795-74942817 GGGCCTGCCCCCTCCTCCATAGG - Intronic
1128228620 15:66019604-66019626 CAGCAGACCGGCTCCTCCAGGGG + Intronic
1129454733 15:75670603-75670625 TGGCTGCCCTGCTCCTCCATGGG + Intergenic
1131223788 15:90607434-90607456 CGACTGGCCCCCTCCTCCATAGG - Exonic
1132821170 16:1872001-1872023 CGCCCGGCCGGCTGCTCCCCGGG + Exonic
1137591960 16:49699235-49699257 CGGCTGGCCGGCTCCCCCGGGGG + Intronic
1141598686 16:85112515-85112537 CGGGCGACCGGCTCCTCCTAGGG - Intergenic
1143183395 17:4997562-4997584 CCGCCCGCCGGCTCCTCCCGCGG - Intronic
1146492362 17:33292153-33292175 CGGCCGGGCGGAGCCGCCATGGG + Exonic
1146895061 17:36534952-36534974 GGGTCGGCCGGCTCCTCCCTAGG + Exonic
1154270169 18:12911873-12911895 AGGCCTGCCAGCTCCTCCAAGGG - Intronic
1165089147 19:33373667-33373689 CGGCAGGCCGGCGCTCCCATTGG + Exonic
1166000042 19:39872362-39872384 CGGGCGCCCGGCTCCTCCAAGGG - Exonic
941979036 2:171434560-171434582 GGCCCGGCCCGCGCCTCCATGGG + Exonic
948091517 2:235300104-235300126 CGGCCGGCAGGCTACTCTTTAGG - Intergenic
948662335 2:239515207-239515229 CTGCAGGACGGCTCCTCCCTCGG + Intergenic
1170924792 20:20712721-20712743 GGGCCGGCCGGCACCTCCCGCGG - Intergenic
1174358764 20:50015226-50015248 CTGCCTGCCGGCCCCCCCATCGG + Intergenic
1175974871 20:62705744-62705766 GGACCGGCCGGCTCCTCAACAGG + Intergenic
1175997234 20:62817294-62817316 CGTCCGGCCGCGTCCTCGATGGG + Intronic
1176147672 20:63572683-63572705 CGCCCGGCCTGCCCCTCCCTGGG + Intronic
1179133606 21:38660709-38660731 CGGCCGCCCTGCTCCGCGATTGG - Intronic
1180791525 22:18577805-18577827 CGGCCGGCCGGCCCTACCAGCGG + Intergenic
1181230215 22:21417506-21417528 CGGCCGGCCGGCCCTACCAGCGG - Intronic
1181248434 22:21517357-21517379 CGGCCGGCCGGCCCTACCAGCGG + Intergenic
1181315981 22:21971119-21971141 CTGCAGGGCGGCTCCTCCCTGGG - Intronic
1184370118 22:44076777-44076799 GGGCAGGCCACCTCCTCCATGGG - Intronic
953883065 3:46701438-46701460 CGGCCGGCCCGTTCGTCCCTGGG + Exonic
954401263 3:50321106-50321128 CGGGCGGCCGGCGCCGCCGTGGG - Exonic
955916276 3:63911941-63911963 CGGCCGGCCGGCTCCTCCATAGG + Intronic
962118759 3:132540308-132540330 CGTCCAGCTGGCTCCTCCCTGGG - Intergenic
987023703 5:13901396-13901418 GGGCCCGCCAGCTCTTCCATAGG - Exonic
992654604 5:78895992-78896014 CTGCCCCCCGGCTCCTCCAGGGG - Intronic
1002517035 5:179766343-179766365 GGGCTGGCAGGCTTCTCCATGGG - Exonic
1015849860 6:137560475-137560497 TGGCCAGGAGGCTCCTCCATGGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019514042 7:1432002-1432024 CCGCCGCCCGGCTCCTGCAGAGG - Intronic
1028070077 7:86440654-86440676 GGGCCGGCCGGCTGCTCCGGGGG - Intergenic
1033597080 7:142865949-142865971 CGGCCCCCCAGGTCCTCCATCGG + Exonic
1034179455 7:149126301-149126323 CGCCCGGCCGGCTCTGCCTTTGG - Exonic
1042575801 8:70217384-70217406 CTGCCTGGCTGCTCCTCCATCGG + Intronic
1048981160 8:139703899-139703921 CGGCCAGCCCGCTCCTCCGGGGG + Intergenic
1060103045 9:120856897-120856919 GGGCCTGCTGGCTCCTCCCTTGG - Exonic
1061843837 9:133375896-133375918 CGGCCTGCGGGCTCCTCCCCCGG - Intronic
1062195181 9:135269062-135269084 CGACCAGCGGGCTCCTCCAAGGG + Intergenic
1062346597 9:136118083-136118105 CCTCCGCCCGGCTCCTCCACGGG + Intronic
1062547575 9:137070511-137070533 CGCCGGGCCGGCCCCTCCGTGGG - Exonic
1188441963 X:30222020-30222042 GGGCCTGCCAGCTCCTCCCTAGG - Intergenic
1192847943 X:74925179-74925201 CGGCTGCCCGGCTGCTCCAAGGG + Exonic
1200208065 X:154332298-154332320 CTGCTGGCTGGCTTCTCCATGGG - Intergenic