ID: 955919382

View in Genome Browser
Species Human (GRCh38)
Location 3:63939537-63939559
Sequence ATGGCAGAGCAGATTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955919382_955919385 -3 Left 955919382 3:63939537-63939559 CCTCCAAAAATCTGCTCTGCCAT 0: 1
1: 1
2: 2
3: 35
4: 255
Right 955919385 3:63939557-63939579 CATAAAAGCAATAAAAGCACTGG 0: 1
1: 0
2: 14
3: 78
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955919382 Original CRISPR ATGGCAGAGCAGATTTTTGG AGG (reversed) Intronic
900685927 1:3947647-3947669 ACGGCAGAGGATTTTTTTGGGGG - Intergenic
908399240 1:63754871-63754893 AAGAAAGAGCAGATTTTGGGGGG + Intergenic
908812942 1:68002756-68002778 ATGTCAGAGAAGAGGTTTGGTGG - Intergenic
911824503 1:102464411-102464433 ATGGGAGAGCAGTTATTTGAAGG - Intergenic
914762428 1:150609968-150609990 ATGGAAGAGCAGAATTGTGGAGG - Intronic
916481328 1:165217350-165217372 ATGGCACAGCAGTTCTTTGGGGG - Intronic
916605605 1:166339469-166339491 ATCGCAGAGCAGAGATTTGCGGG - Intergenic
917448774 1:175128857-175128879 ATGGAAGAGAGGAGTTTTGGTGG + Intronic
919148606 1:193666442-193666464 AAGGCAGAGCAGATTTGAGAAGG - Intergenic
919836488 1:201578154-201578176 AAAGCAGAGCAGATTCTTAGGGG - Intergenic
920740935 1:208580737-208580759 ATGGAAGAGCAGGGTTTTGAAGG - Intergenic
921025544 1:211277332-211277354 ATGGAAGAGAACATTTTTGGTGG + Intronic
921300628 1:213748336-213748358 ATGAAGGAGCAGATTTTTGAGGG + Intergenic
921745079 1:218731286-218731308 ATGTCACTGCAAATTTTTGGTGG + Intergenic
922622805 1:227003683-227003705 GTCGCGGAGCAGCTTTTTGGTGG - Intronic
922889823 1:229053108-229053130 GTGGGAGAGAAGATTTTTTGGGG - Intergenic
923446126 1:234072938-234072960 ATGGCAAAGCAGATGGTGGGAGG + Intronic
923479688 1:234372576-234372598 ATTGCAGAACACATATTTGGTGG + Intergenic
923558981 1:235023930-235023952 AAGGCAGAGCACATTTCTGTAGG - Intergenic
923887511 1:238175758-238175780 ATGGCAAAACAGATTATGGGCGG - Intergenic
923921475 1:238569216-238569238 ATGAAAGAGAAGACTTTTGGAGG - Intergenic
924269924 1:242321660-242321682 ATGGCAGAACAGGTTATGGGAGG - Intronic
924376814 1:243419185-243419207 ATGTCAGAGTACATTCTTGGTGG - Intronic
1063452187 10:6157601-6157623 ATAGCAGACGAGATTCTTGGAGG - Intronic
1065289572 10:24216180-24216202 ATGGAAGGGGAGAGTTTTGGGGG - Intronic
1065439461 10:25735972-25735994 GTGGAAGAGCAGATTTCTGGAGG - Intergenic
1065650365 10:27882481-27882503 ATGGAGGATAAGATTTTTGGAGG - Intronic
1066240979 10:33534609-33534631 ATGGCAGTGCTCATTTGTGGAGG + Intergenic
1066631868 10:37466065-37466087 ATTGCACAGGAGATTTTTGGGGG - Intergenic
1066696788 10:38086125-38086147 CTGGCAGAACAGACTTTTTGTGG - Intergenic
1066714988 10:38277106-38277128 ATGGCAGAACAGGTTATGGGAGG + Intergenic
1066783092 10:38973594-38973616 ATGGCAGAACAGGTTATGGGAGG - Intergenic
1066995772 10:42561595-42561617 CTGGCAGAACAGACTTTTTGTGG + Intergenic
1067086137 10:43239402-43239424 ATGGAAGAGAGGGTTTTTGGAGG - Intronic
1068259349 10:54558084-54558106 ATTGCATATCAGATTTCTGGTGG - Intronic
1068732650 10:60376178-60376200 ATAGGAAAACAGATTTTTGGAGG - Intronic
1070199649 10:74191319-74191341 ATGGAAGAGAGGATTTTTGGAGG + Intronic
1073717311 10:106121876-106121898 ATGGAACCGCAGGTTTTTGGTGG - Intergenic
1075827175 10:125368986-125369008 TGTGCAAAGCAGATTTTTGGAGG + Intergenic
1076013201 10:127006814-127006836 ATGGCAGAGCAGAGCTCTGCAGG + Intronic
1079114300 11:17631220-17631242 CTGGTAAAGCAGACTTTTGGGGG + Intronic
1079324703 11:19481553-19481575 ATGGAAGAGCAGAGGTTTAGAGG - Intronic
1079355840 11:19729836-19729858 ATAGGAGAGCAAATTTTGGGGGG + Intronic
1080367471 11:31592115-31592137 ATGGGTGTGCAGTTTTTTGGGGG + Intronic
1080635652 11:34121053-34121075 GTGGAGGAGGAGATTTTTGGAGG + Intronic
1081160256 11:39740555-39740577 GTGGCAGTGAAAATTTTTGGGGG - Intergenic
1082222501 11:49656930-49656952 ATGGAAGAGTGGATATTTGGAGG + Intergenic
1082916000 11:58438031-58438053 ATGGAAGAGCAGATTTTTGGAGG - Intergenic
1083089963 11:60189662-60189684 ATCCCAGAGCAGATGTGTGGTGG + Intergenic
1083636045 11:64121498-64121520 GTGACACAGCAGATATTTGGGGG - Intronic
1085792641 11:79509169-79509191 TTAGCAGAGCAGATTATTGTTGG + Intergenic
1086372783 11:86171613-86171635 ATGGCAGGGCAGCTATTTGATGG - Intergenic
1086419520 11:86624751-86624773 ATGCCAGAGGAGAAGTTTGGAGG - Intronic
1086626549 11:88962276-88962298 ATGGAAGAGTGGATATTTGGAGG - Intronic
1086993748 11:93333370-93333392 ATGGCAGAGCACACTTATGATGG - Intronic
1087499369 11:98931185-98931207 ATGGAAAAGCAGCTGTTTGGTGG - Intergenic
1089827185 11:121289085-121289107 CTGGCAGAACAGATTCTTTGTGG - Intergenic
1089883329 11:121795586-121795608 AAGGCAAAGGATATTTTTGGGGG + Intergenic
1092709934 12:11325339-11325361 AGGGGAGAGCAGGTTTTAGGAGG - Intergenic
1092710422 12:11330889-11330911 AGGGGAGAGCAGGTTTTAGGAGG - Intergenic
1092713703 12:11365832-11365854 AGGGGAGAGCAGGTTTTAGGAGG - Intronic
1092714511 12:11375047-11375069 AGGGGAGAGCAGGTTTTAGGAGG - Intronic
1092717405 12:11405017-11405039 AGGGGAGAGCAGGTTTTAGGAGG - Intronic
1092718221 12:11414066-11414088 AGGGGAGAGCAGGTTTTAGGAGG - Intronic
1093084324 12:14849912-14849934 AAGGCAAAGCAGCTTTTTTGGGG + Intronic
1093153871 12:15656778-15656800 TGGGTAGAGCAGGTTTTTGGAGG - Intronic
1095214938 12:39537249-39537271 ATGGTAGAGCAAGTTTTAGGGGG - Intergenic
1096770791 12:53934732-53934754 ATGGAAGAGGAGATTTGTGGAGG - Intergenic
1097418332 12:59342270-59342292 ATGGCAGTTCTGATTTTTTGAGG + Intergenic
1097902462 12:64886950-64886972 ATTGAAGAGAAGACTTTTGGAGG - Intergenic
1101065980 12:101021135-101021157 ATGGCAGTGCAGTTTGCTGGGGG + Intronic
1102146434 12:110658366-110658388 GTGGGAGATCAGATTTGTGGAGG - Intronic
1102941260 12:116944285-116944307 ATGGAGGAGCAGGTCTTTGGAGG + Intronic
1102948064 12:117007479-117007501 ATTACAGAGCAAATTTTTGCAGG - Intronic
1103196876 12:119051801-119051823 ATGGTAGAACTGATGTTTGGTGG + Intronic
1104944793 12:132410764-132410786 ATGGCAAAGGACCTTTTTGGGGG + Intergenic
1107748070 13:43534057-43534079 AAGCCAGTGCAAATTTTTGGAGG - Intronic
1110142666 13:72149909-72149931 ATGGCTGAGCAGATTCCTGCTGG + Intergenic
1110302757 13:73948512-73948534 ATGGCATAGCAGATTCTTAAAGG + Intronic
1110804198 13:79736079-79736101 ATGGCAGAGGAGCTGTTTGTTGG + Intergenic
1111039378 13:82725470-82725492 TTTGCAGAACACATTTTTGGTGG + Intergenic
1111060078 13:83006143-83006165 ATAAAAGAGCAGATTTTTGATGG - Intergenic
1113085276 13:106563719-106563741 ATGGAACCGCATATTTTTGGAGG - Intronic
1114511810 14:23268531-23268553 ATGGAGGAGGAAATTTTTGGAGG + Intronic
1115343542 14:32318164-32318186 GTCCCAGAGCAGATTTTAGGTGG + Intergenic
1117380151 14:55154125-55154147 ATGGCAGAGCATATTGAAGGGGG - Intronic
1121544492 14:94753437-94753459 GGGGAAGAGCAGACTTTTGGGGG + Intergenic
1121915886 14:97836677-97836699 ATGCAGGAGCAGATCTTTGGGGG + Intergenic
1121957038 14:98223616-98223638 ATGGCAGATTAGACTTTGGGAGG + Intergenic
1125411509 15:39411019-39411041 ATGCCACAGCCGTTTTTTGGGGG - Intergenic
1126217549 15:46173772-46173794 CTGGAAGAGCATATTATTGGTGG - Intergenic
1126358601 15:47822440-47822462 TTGGCAAAGCCTATTTTTGGGGG + Intergenic
1128851183 15:70958412-70958434 ATAGAAAAGCAGATTTGTGGAGG + Intronic
1129987805 15:79934099-79934121 ATTGCACAGCAGAATTTTGGTGG - Intergenic
1130774330 15:86962269-86962291 GTGGGAGAGAGGATTTTTGGTGG + Intronic
1132362334 15:101226975-101226997 AGGGCAGACAGGATTTTTGGAGG - Intronic
1132850219 16:2021691-2021713 ATGGCAGGGCACATTTATGTGGG - Intergenic
1133953848 16:10422735-10422757 AAGGCAAAGCAGCTTATTGGGGG - Intronic
1135388357 16:22065866-22065888 ATAGAGGAGCAGATTTTTGGAGG - Intronic
1136690430 16:32024722-32024744 ATGGCCGAGCACATGTGTGGGGG - Intergenic
1136791019 16:32968282-32968304 ATGGCCGAGCACATGTGTGGGGG - Intergenic
1136878794 16:33885650-33885672 ATGGCCGAGCACATGTGTGGGGG + Intergenic
1140404041 16:74695905-74695927 AGGGCAGAACAGATTTTGGTGGG - Intronic
1140559863 16:75966533-75966555 ATGGAGGAGAGGATTTTTGGAGG + Intergenic
1140632720 16:76873298-76873320 ATGTCAGGGCAGATTTGTCGGGG + Intergenic
1140670698 16:77275590-77275612 GTAGCAGAGCATTTTTTTGGGGG + Intronic
1203093226 16_KI270728v1_random:1229743-1229765 ATGGCCGAGCACATGTGTGGGGG - Intergenic
1142576163 17:909443-909465 ATGTCAGAACAGGTTTTCGGTGG - Intronic
1144403079 17:14925598-14925620 GTGGAAGAGCTGATATTTGGAGG + Intergenic
1144935760 17:18897390-18897412 ATGGAGGAGCAGATTTTTTAGGG + Intronic
1144939572 17:18928696-18928718 GTGGAAGAGCAGATTTTTCACGG + Intronic
1146271697 17:31489193-31489215 AGGGCAGGGCAGAAGTTTGGTGG - Intronic
1147153290 17:38530857-38530879 ATGGCCGAGCACATGTGTGGGGG - Exonic
1150502338 17:65663350-65663372 ATGGCAAAGTAGATGTTTGATGG + Intronic
1151698030 17:75727974-75727996 ATGGAAGGGAAGGTTTTTGGGGG - Intronic
1154400704 18:14034354-14034376 CTGTCCGAGCAGATCTTTGGAGG + Intergenic
1155247153 18:23921643-23921665 ATGGCAGACCAGATTTTTTTTGG - Intronic
1155428692 18:25732997-25733019 ATGACAAATCAGGTTTTTGGTGG + Intergenic
1157216428 18:45787264-45787286 AGGGCAGAGCTGAGTTTGGGGGG + Intergenic
1158817196 18:61116059-61116081 AAGGCAGAGCATATTCTTGTTGG - Intergenic
1159251802 18:65889153-65889175 ACGGCAGACCAGATTTTCTGAGG + Exonic
1159979567 18:74760968-74760990 ATGGAGGAGCAGATTTTTGGAGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161524208 19:4743371-4743393 ATGAGAGAGAAGATGTTTGGGGG + Intergenic
1162870193 19:13580668-13580690 ATGGCACAGTGGAGTTTTGGAGG - Intronic
1164635832 19:29790933-29790955 ATTGAAGAACAGATTTTTGGGGG - Intergenic
1164705890 19:30319570-30319592 ATTGCAGGGCAGATTTTTAGAGG + Intronic
1164878398 19:31709809-31709831 ATGGGACAGCAGAATTCTGGAGG - Intergenic
1166605805 19:44141720-44141742 GTGGGAGAGCAGAGGTTTGGTGG + Exonic
1167086066 19:47310413-47310435 ATGGCAGAGAAAATGTTGGGAGG + Intronic
1167244292 19:48364478-48364500 ATGGCAGTGCTGAGGTTTGGGGG - Exonic
1168647428 19:58068900-58068922 ATTGCACATCACATTTTTGGGGG + Exonic
925497564 2:4469269-4469291 ATGCCATTGCAGAGTTTTGGAGG - Intergenic
925686122 2:6475758-6475780 AGTGCAGCTCAGATTTTTGGTGG - Intergenic
925746879 2:7051134-7051156 AAGTCAGAGCAAATTTCTGGAGG + Intronic
925895990 2:8472664-8472686 ATTGCAGCGAAGATTTTGGGTGG - Intergenic
926939728 2:18122323-18122345 ATGGTGGAGAAGACTTTTGGAGG + Intronic
928480696 2:31680386-31680408 ATGGTAGATAAGATTTTTGATGG + Intergenic
929445525 2:41997986-41998008 ATGGCAGTGCTGTTTTTTGGGGG - Intergenic
931155010 2:59618109-59618131 ATGGAAGAGCAGATTCTCAGAGG + Intergenic
933649443 2:84838421-84838443 ATGGAAGAACAGGTTTTTGGAGG + Intronic
937311104 2:120903981-120904003 TGGGCAGTGCAGAGTTTTGGGGG + Intronic
937817293 2:126265436-126265458 ATGGATGATCAGATTTTTGGTGG - Intergenic
938589059 2:132719866-132719888 GAGGCAGAGCAGATTTCTAGAGG + Intronic
939100626 2:137891029-137891051 AGGGCACAGATGATTTTTGGAGG + Intergenic
939484516 2:142793609-142793631 ATTGCAGAGTAGATTTCTGTAGG - Intergenic
939608409 2:144280454-144280476 AAGGCAGTGCAGGATTTTGGGGG + Intronic
939615620 2:144359034-144359056 ATGACAGAGAAGTTTTTGGGGGG + Intergenic
940219718 2:151339283-151339305 ATGGAAGAAGAGATTTTTGAGGG - Intergenic
941255053 2:163218773-163218795 ATGGAAGAGCATATTTTTGAAGG - Intergenic
944859214 2:203798699-203798721 ATGAAAGAGCAGATTTCTGAAGG - Intergenic
945116089 2:206409559-206409581 ATGGCAGAGCAGTCCCTTGGGGG - Intergenic
945735709 2:213597768-213597790 ATGTCAGAGAAGTTTTTGGGGGG - Intronic
946051059 2:216863044-216863066 TTGGCAGAGCAGATCTTTTGGGG - Intergenic
946380486 2:219345299-219345321 ATGGCTGAGTAGATTCTTGCAGG - Intergenic
946758823 2:222973104-222973126 TTGGAAGGGCAGGTTTTTGGGGG + Intergenic
946770848 2:223086768-223086790 AAGGCAGAGCTGATATTTGCTGG + Intronic
947811112 2:233004472-233004494 AGGGCAGAGCAGATTCCAGGGGG - Intronic
1169761750 20:9102725-9102747 ATGCCAGAGCATATTTGGGGGGG + Intronic
1172153362 20:32806288-32806310 ATGGCAAAGAAGATGTTTTGTGG + Exonic
1172185346 20:33028011-33028033 AGGGCAGAGCATATTTGGGGTGG - Intergenic
1172743739 20:37190227-37190249 ATGGCAGAGAATAGCTTTGGGGG - Intronic
1175033197 20:55975183-55975205 ATGGCAGGGCAGAGGTGTGGTGG - Intergenic
1175681415 20:60991578-60991600 ATGGCACATCAGATTTACGGTGG + Intergenic
1176604633 21:8819414-8819436 ATGGCAGAGCATGGTTTGGGTGG - Intergenic
1177307451 21:19337587-19337609 ATTGCAGAGCAAATGATTGGTGG - Intergenic
1177604282 21:23358536-23358558 ATGCCAGGGCAGATATTTAGGGG + Intergenic
1178094902 21:29204122-29204144 ATGGATGAGCAGATTTTTGATGG + Intronic
1178744681 21:35237432-35237454 ATGGAAGAGTAGACTTCTGGTGG + Intronic
1180346922 22:11711019-11711041 ATGGCAGAGCATGGTTTGGGTGG - Intergenic
1182787885 22:32922903-32922925 ATGGCAGAGAAGATCATTGCTGG - Intronic
1183032370 22:35115844-35115866 ATGGCAAGGCAGATTTTGTGGGG - Intergenic
1184639402 22:45861288-45861310 AAGAAAGAGCAGGTTTTTGGTGG - Intergenic
950845037 3:16007041-16007063 ATGAAGGAGTAGATTTTTGGAGG + Intergenic
951864171 3:27288873-27288895 ATGGGACAGCAGGTTTTTGGTGG - Intronic
953473279 3:43184644-43184666 TTGGCAGATCAGCTTTTTGTTGG + Intergenic
953663680 3:44909855-44909877 ATGGAGAAGCAGATTTTTGGAGG + Intronic
954372419 3:50175750-50175772 ATGACAGAGCATGTTTGTGGTGG + Intronic
955171257 3:56567628-56567650 ATGGCAAAACAGATTATGGGAGG + Intronic
955919382 3:63939537-63939559 ATGGCAGAGCAGATTTTTGGAGG - Intronic
956164573 3:66386725-66386747 ATGGAGGTGCAGATTTTTGGAGG - Intronic
956844822 3:73172946-73172968 ATGGGAGACCAGGTATTTGGTGG - Intergenic
956854161 3:73259529-73259551 GAGGCAGTGCAGATTTTTGGAGG - Intergenic
956943498 3:74192812-74192834 ACGAAAAAGCAGATTTTTGGAGG + Intergenic
957291539 3:78283109-78283131 AAGCCAGAAGAGATTTTTGGGGG + Intergenic
961946812 3:130699669-130699691 ATGGAGGAACAGATTTTTGGAGG + Intronic
962014626 3:131427244-131427266 AAGACTGAGCAGATGTTTGGTGG + Intergenic
963823357 3:149924221-149924243 ATGAGAGAGCAGGTTTTAGGAGG + Intronic
964191281 3:154003960-154003982 ATGGCAGAACAGGTTATTGAAGG - Intergenic
964787871 3:160419541-160419563 TTGGTAAAGTAGATTTTTGGGGG + Exonic
965467479 3:169048483-169048505 ATGGAAGAGCTGATTAATGGAGG + Intergenic
965770020 3:172172075-172172097 ATAGCAGAGCATATGTTTGCAGG - Intronic
967884519 3:194324043-194324065 ATGGCAGAGGAGTGGTTTGGGGG - Intergenic
968867076 4:3219970-3219992 AGGGCAGAGCAGATTTGGGAGGG + Intronic
970053652 4:11946857-11946879 ATAGCTAAGCAGATTTTTAGAGG + Intergenic
973106258 4:46342308-46342330 ATGCAGGAGCAGATTTTTGGAGG + Intronic
973225621 4:47780537-47780559 GTGGAGGAGTAGATTTTTGGAGG - Intronic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
976357486 4:84136205-84136227 AGGGGAAAGCAGATTTTTGGTGG - Intergenic
976396146 4:84557737-84557759 ATGGCAAAGCACATTCATGGAGG - Intergenic
976850547 4:89540443-89540465 AAGGCAGAGCAGATCTTCTGTGG - Intergenic
978642039 4:110882139-110882161 AGGGAAGAACAGATTTTTTGGGG + Intergenic
979187681 4:117818856-117818878 ATGGAAGAGCAGACTTTCTGAGG + Intergenic
980119870 4:128716590-128716612 ATGGCAGTGTAGACTTCTGGTGG + Intergenic
980311007 4:131128740-131128762 ATGGCAGAGAAGATGGTGGGGGG + Intergenic
981592634 4:146381364-146381386 ATGTTAGAGTAGATTTCTGGGGG - Intronic
982381850 4:154757422-154757444 ATGCCTGAACAGATTCTTGGGGG - Intergenic
983237754 4:165199031-165199053 ATTAGAGAGCAGATTTATGGTGG - Intronic
986884798 5:12220109-12220131 ATGGGAATGCAGACTTTTGGGGG + Intergenic
988172377 5:27675560-27675582 ATGTCAGAGCAGCAATTTGGTGG + Intergenic
989531887 5:42516957-42516979 ATGTCAGTGTAGATTTTTAGGGG + Intronic
991935926 5:71800200-71800222 TAGGTAGAGCAGATTTTTGAAGG + Intergenic
992264887 5:75008748-75008770 AAGACAAAGCAGATTTTTAGAGG + Intergenic
992927122 5:81599678-81599700 ATGTCAGAGCTGAATTTTGAAGG - Intronic
994311811 5:98281453-98281475 ATGTCAGACCAGATATTTTGAGG - Intergenic
994963410 5:106635059-106635081 ATAGCAGAGCAGCTTTTTGATGG + Intergenic
995160957 5:108981237-108981259 AAGTCAGAGCATATTTATGGGGG + Intronic
995378434 5:111504672-111504694 ATGAGAGAGCAGATTTATGGTGG - Intronic
995425651 5:112019459-112019481 ATGGCAAAGAGGATTTTTGCAGG - Intergenic
995427300 5:112039854-112039876 ATGGCAGAGCAGAACTCTGGGGG - Intergenic
995670291 5:114595256-114595278 ATGCCAGAGAAGATTTTTTAAGG - Intergenic
998415507 5:141943440-141943462 AGTGCAGAGCAGATGTTGGGAGG - Intergenic
998892336 5:146759555-146759577 ATGCCTGAGCAGAGTCTTGGAGG - Intronic
1000175586 5:158749328-158749350 ATGGCATTGCATATTTTGGGAGG - Intronic
1006177272 6:32129971-32129993 AAGCTGGAGCAGATTTTTGGAGG - Intronic
1006451560 6:34108625-34108647 ATGGCAGACCTGATTTGGGGTGG + Intronic
1008221724 6:48862593-48862615 ATGGCAGAAAAAATTTTTGTAGG - Intergenic
1009273147 6:61641067-61641089 AAGGCAGAGCACTTCTTTGGAGG - Intergenic
1009429371 6:63549223-63549245 GTAGCAGAGCAGCTGTTTGGTGG + Intronic
1010033218 6:71290626-71290648 ATTGAAAAGCAGATTTTTTGGGG - Intronic
1010626024 6:78137136-78137158 ATGGAAAAGCAGCTATTTGGTGG + Intergenic
1012150834 6:95749559-95749581 GTGACAGAGGAGAGTTTTGGGGG - Intergenic
1012817612 6:104043819-104043841 CTGGCAGAGTAGACTTCTGGTGG + Intergenic
1014317096 6:119881534-119881556 ATGGCAGAGCAGAGTCCTGGAGG - Intergenic
1014727463 6:124989532-124989554 ATGGCAGAGCTGAGTTGTGATGG - Intronic
1015212360 6:130712733-130712755 ATTGCAGATCAAATTTTTTGAGG - Intergenic
1016012602 6:139153914-139153936 ATGGAGGAGCAAATTTCTGGAGG - Intronic
1016114907 6:140268449-140268471 ATTGCAAAGCATAATTTTGGGGG + Intergenic
1019926588 7:4197047-4197069 ATTGCACAGCAGATCGTTGGAGG - Intronic
1020043815 7:5024688-5024710 ATCCCAGAGCAGATGTATGGTGG - Intronic
1021081942 7:16374893-16374915 ATAGAAGGGCTGATTTTTGGAGG - Intronic
1021516743 7:21497525-21497547 ATGGAAGAGCAAAGTTTTGGAGG + Intronic
1022283055 7:28929947-28929969 ATGGCTGAGATGATTTTAGGTGG + Intergenic
1022812674 7:33885236-33885258 TTGGAAGAGCAGCTCTTTGGAGG + Intergenic
1023185824 7:37531795-37531817 ATGGCAGAGCATCTTTTTTCTGG + Intergenic
1025075774 7:55941768-55941790 ACGGCACACAAGATTTTTGGGGG - Exonic
1028876586 7:95830387-95830409 AAAGCAGATCAGATGTTTGGGGG - Intronic
1029726693 7:102410734-102410756 ATGGAGGAGCAGATTTTTGGAGG + Intronic
1029913809 7:104184945-104184967 ATGGCATAACAGGTTATTGGAGG - Intronic
1030565384 7:111147752-111147774 ATGGAGGAGTAGATTTTTGGAGG - Intronic
1031590367 7:123583407-123583429 CTGTCAGAGAAGACTTTTGGAGG - Intronic
1032887884 7:136162042-136162064 ATGTCAGAAAAGATTTTTAGAGG + Intergenic
1034158287 7:148973461-148973483 ATGGCAGAGCAGACTTGGGTGGG - Intergenic
1034859129 7:154581310-154581332 CTGGCAGAGGAGATTTGTGTGGG + Intronic
1035274954 7:157742552-157742574 ATGGCAGGGCAGCATTTTGGAGG + Intronic
1036117929 8:5980212-5980234 ATGGAAGAGAGGCTTTTTGGAGG - Intergenic
1036656013 8:10677978-10678000 AAGGCTGAGCAGATTTCAGGAGG - Intronic
1038422712 8:27443654-27443676 AAGGAAGTGCAGGTTTTTGGAGG - Intronic
1041628124 8:60054893-60054915 AGGGGAGAGGAGATTGTTGGAGG + Intergenic
1043514403 8:80982698-80982720 CAGGCAGAGCAGGTTTTGGGGGG - Intronic
1044055215 8:87561310-87561332 AGGGAAGAGAAAATTTTTGGAGG - Intronic
1047696909 8:127412773-127412795 AAGGGAGAGCAGATCTTGGGAGG + Intergenic
1048434254 8:134401238-134401260 ATGGCAAAGCAGGTTTTTAGAGG + Intergenic
1050060831 9:1708094-1708116 AAGGCAGAGGATATTTTTGAAGG - Intergenic
1051664000 9:19451139-19451161 ATGGCAGAGCAGTCCCTTGGGGG + Exonic
1052474338 9:28939264-28939286 ATGGAATAGTAGATTTTTGAGGG - Intergenic
1053361327 9:37488649-37488671 ATGGCACAACAGTTTTATGGAGG - Intronic
1055366557 9:75550460-75550482 GTGGCAGGGCAGATCTGTGGAGG - Intergenic
1057961265 9:99459538-99459560 ATGGCAGAGCAGAGAAGTGGGGG + Intergenic
1059640832 9:116215108-116215130 ATGACAGAGAAGATGTTTGAAGG + Intronic
1059680153 9:116577942-116577964 ATGGGAGAGGAGATCATTGGGGG + Intronic
1061394380 9:130335783-130335805 ATGGCAGAGCAGATGGGTGCGGG - Intronic
1061940175 9:133879681-133879703 AAGGGAGAGCAGGTTCTTGGTGG - Intronic
1062171896 9:135139377-135139399 ATGGCAGAGCAGATGCTGGAAGG - Intergenic
1062320698 9:135989308-135989330 CTGGCAGAGCAGCCTCTTGGGGG - Intergenic
1186447358 X:9643032-9643054 AAGGCACTGCAGATATTTGGGGG + Intronic
1187322102 X:18249105-18249127 ATGAAGGAGTAGATTTTTGGAGG - Intronic
1189095113 X:38130300-38130322 ATGGCAGAGCTGAATTTGGGTGG - Intronic
1189146919 X:38664997-38665019 ATGGTATAGCATATATTTGGTGG + Intronic
1189310834 X:40016114-40016136 TTGGCCAAGCAGATTTTGGGGGG + Intergenic
1189811681 X:44786668-44786690 ATGGAAGTGCAGATTTGTGGAGG - Intergenic
1190488082 X:50950007-50950029 CTAGAAGAGCAGATTTATGGAGG + Intergenic
1190594111 X:52035855-52035877 TTGGAAGAGCAGAATTTTGCTGG - Intergenic
1190905325 X:54721579-54721601 ATGGCAGAGAAGAGTTTTCAAGG - Intergenic
1191773060 X:64783450-64783472 ATGGAAAAGCAGCTTTTTTGTGG - Intergenic
1192242756 X:69347598-69347620 AAGGAGGAGCAGATTTTTAGAGG + Intergenic
1194069744 X:89306635-89306657 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1195413746 X:104597662-104597684 GAGGCACAGCAGGTTTTTGGGGG + Intronic
1196604273 X:117638089-117638111 ATGTCAGAGCATCTATTTGGGGG + Intergenic
1196842505 X:119871591-119871613 ATGGCAGAGCAGCTTTCTCCAGG - Exonic
1198138483 X:133778923-133778945 ATTGCAGACCATATTTTTAGAGG - Intronic
1198213536 X:134536462-134536484 ATGGCAGAGCAGGGTTGGGGAGG + Intergenic
1200723891 Y:6640776-6640798 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1201603026 Y:15751384-15751406 ATGACAGAGCACATATTTGATGG - Intergenic