ID: 955920026

View in Genome Browser
Species Human (GRCh38)
Location 3:63945948-63945970
Sequence CAGAGTAACCAGATGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955920026 Original CRISPR CAGAGTAACCAGATGCAGAG AGG Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
902788805 1:18751108-18751130 CAGTGTAAACAGCTGCAGTGAGG + Intergenic
903046841 1:20570886-20570908 CAGAGTTACTAAAGGCAGAGGGG - Intergenic
904644569 1:31956171-31956193 CAAGGAAACTAGATGCAGAGTGG + Intergenic
905643965 1:39611632-39611654 CAGATTAGCTAGATACAGAGTGG + Intergenic
905826781 1:41031682-41031704 GAGAGAAACCAAGTGCAGAGAGG + Intronic
907550178 1:55298536-55298558 CAGAGTAAGCAGGGGCAGATGGG + Intergenic
907786827 1:57620714-57620736 GAGAGAACACAGATGCAGAGAGG + Intronic
907807135 1:57832226-57832248 AAGAGTAACTAGATGAAGAGAGG + Intronic
908673573 1:66576087-66576109 CACAGTAATAAGATGCAGATGGG + Intronic
909759340 1:79269726-79269748 CAGAGTAGCTAGATACAGTGTGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911177413 1:94830970-94830992 CTGAGAAAACTGATGCAGAGAGG + Intronic
911367940 1:96962146-96962168 CAGAGAATCCAGGTTCAGAGTGG + Intergenic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
914974621 1:152349868-152349890 CAGTGCAACCATATGCAGTGGGG - Exonic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
917817632 1:178725943-178725965 CAGGGTGACCTGTTGCAGAGCGG + Intronic
917851489 1:179068584-179068606 AAAATTAACCAGATGCAGTGAGG - Intronic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
920226639 1:204443813-204443835 AGGAGAAACAAGATGCAGAGGGG - Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921334565 1:214073365-214073387 CAGAGTATTCATATTCAGAGAGG + Intergenic
921742185 1:218698008-218698030 CAGAGTATCCAGATTTAGGGAGG + Intergenic
922255086 1:223886791-223886813 CAGAGTAAACAGGTGGAGATGGG - Intergenic
922821689 1:228489027-228489049 CAGAGTCAGCAGCTGCAGTGTGG + Exonic
922861344 1:228818936-228818958 CAGAACAACCATTTGCAGAGAGG + Intergenic
923039409 1:230309035-230309057 CAGAGTCACCAGAAGCGGTGCGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
923992603 1:239455482-239455504 CAGTGAAACAAGATGTAGAGGGG + Intronic
924890280 1:248270505-248270527 CAGAGAGACCAAATGCAGATTGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1063224797 10:4005467-4005489 CACAGTGACCAGCTGCACAGTGG - Intergenic
1067970735 10:50967577-50967599 CAGAGAAATCAAAGGCAGAGTGG + Intergenic
1069574133 10:69514929-69514951 AAGAGGAACCAGAAACAGAGAGG - Intergenic
1069913107 10:71771800-71771822 CAGAGCACCCAGTAGCAGAGAGG - Intronic
1070102187 10:73398871-73398893 CAGAGCAGCAATATGCAGAGTGG + Intronic
1072594845 10:96862004-96862026 CAAAGTAATCAAATGCAAAGAGG - Intronic
1072620993 10:97079111-97079133 ATGAGTAACCAGACTCAGAGAGG - Intronic
1072755135 10:98015289-98015311 CAGAGTAGTCAGATTCATAGAGG + Intronic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1075651301 10:124129568-124129590 CAGAGGCAGCAGCTGCAGAGTGG - Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1077540180 11:3142990-3143012 CAGAGGAGGCAGGTGCAGAGGGG + Intronic
1077540206 11:3143065-3143087 CAGAGGAGGCAGGTGCAGAGGGG + Intronic
1077540220 11:3143115-3143137 CAGAGGAGGCAGGTGCAGAGGGG + Intronic
1077540240 11:3143190-3143212 CAGAGGAGGCAGGTGCAGAGGGG + Intronic
1077751231 11:4972159-4972181 TAGAGTAACCAGATATGGAGGGG + Intronic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078423226 11:11229142-11229164 CAGAGGTACCAGCTGCAGATTGG - Intergenic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081699419 11:45143708-45143730 CAGAGAAACCATGTTCAGAGAGG - Intronic
1082072750 11:47952035-47952057 CAGAGTAGGCAGGGGCAGAGCGG + Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1084658426 11:70533036-70533058 CAGAGTAGCCAAATTCACAGCGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086492391 11:87368690-87368712 CAGTGTAGGCAAATGCAGAGAGG - Intergenic
1088889973 11:114036522-114036544 CAGAGAATCCTGGTGCAGAGAGG - Intergenic
1089559513 11:119336737-119336759 CAGAAAAACCAGAAGCAGACAGG - Exonic
1090133829 11:124174143-124174165 CATGGAAACCAAATGCAGAGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1093524695 12:20093073-20093095 CAGATTAACTAGATACAGAATGG + Intergenic
1096453687 12:51767824-51767846 CAGACTAACTACATACAGAGGGG - Intronic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1096930357 12:55201131-55201153 CAGTCTAACAAGATGAAGAGAGG + Intergenic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1098588801 12:72185865-72185887 CAGAGCAGCTAGATACAGAGTGG - Intronic
1101825967 12:108220194-108220216 AAGAGAAAACAGGTGCAGAGGGG - Intronic
1102648389 12:114418652-114418674 CAGAGTGATAAGATGGAGAGAGG - Intergenic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1105636903 13:22224404-22224426 GACAGTGACCAGATGCAGGGAGG + Intergenic
1105648268 13:22344828-22344850 CACTGTAACCACATGCAGAAAGG + Intergenic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106755991 13:32823149-32823171 CAGAGTAACAAAATGCCAAGAGG - Intergenic
1106937740 13:34742615-34742637 CAGAGTAGACAGACACAGAGTGG - Intergenic
1107570787 13:41656096-41656118 GAGAGTAACCCGAAGCAGACTGG + Intronic
1108807351 13:54175599-54175621 CAGAGGAATTAGATTCAGAGTGG + Intergenic
1109159766 13:58957898-58957920 CAGAGTAGCTAGATACAGTGTGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1111006745 13:82258526-82258548 CAGATTAGCTAGATACAGAGTGG - Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1115733466 14:36297207-36297229 CACATGGACCAGATGCAGAGTGG + Intergenic
1119218539 14:72888007-72888029 CACAGTCCCCAGATTCAGAGAGG + Intronic
1119392149 14:74298169-74298191 CGGAGTAATCAGAGTCAGAGTGG - Intronic
1119922588 14:78460127-78460149 CAGATGAAAGAGATGCAGAGTGG + Intronic
1120044564 14:79791259-79791281 GAGAGCAACCACAAGCAGAGAGG - Intronic
1121284843 14:92727128-92727150 CAGAGTAGCAAGATGAAAAGAGG + Intronic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1124013981 15:25861410-25861432 CAGAGTAAACGGGTTCAGAGAGG - Intronic
1127732473 15:61813569-61813591 CCGAGTCACCAGAAGCACAGAGG - Intergenic
1129297544 15:74608230-74608252 CAGAGACTCCAGAGGCAGAGTGG - Intronic
1131808269 15:96146122-96146144 CAGAGGAAGCAGAAGCAAAGGGG - Intergenic
1132028238 15:98420728-98420750 CATAGGGACCAGATGGAGAGGGG - Intergenic
1132533090 16:463267-463289 CAGAGTCAGCAGGTGCAGTGAGG + Intronic
1133435886 16:5779220-5779242 CAGAGGGATCAGATCCAGAGGGG - Intergenic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134452934 16:14374422-14374444 AAGAGGAAACAGATGCGGAGAGG + Intergenic
1134888188 16:17813626-17813648 CAGAGGAATCAGAGGCATAGAGG + Intergenic
1135467842 16:22702375-22702397 CACAGAATCCAGGTGCAGAGTGG + Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137747511 16:50834016-50834038 CAGAGTAAACAAATACAAAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1139020710 16:62745401-62745423 CAGAGTAGCCAGGTGAAGGGGGG + Intergenic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1141784909 16:86193095-86193117 CAGGGAAACTAGATCCAGAGAGG + Intergenic
1141800184 16:86302617-86302639 CAGGGTCGCGAGATGCAGAGAGG + Intergenic
1141954482 16:87361266-87361288 CAGAGAAAACAAGTGCAGAGAGG + Intronic
1142220782 16:88853940-88853962 CAGTGTGACCAGTTGGAGAGTGG + Intronic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1142995358 17:3756897-3756919 CAGAGAAACCACATGAAGATGGG + Intronic
1143127886 17:4656296-4656318 CAGAGTAGCTAGATACAGAGTGG + Intergenic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1143882900 17:10043348-10043370 CAGAGAAACCAAATGAAGAGGGG + Intronic
1144318419 17:14087773-14087795 CAGACATACCATATGCAGAGAGG - Intronic
1146465560 17:33083652-33083674 CAGAGGGAGCAGATGCACAGAGG + Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1147732871 17:42614714-42614736 CAGGGCCAGCAGATGCAGAGAGG - Intronic
1147745404 17:42691644-42691666 AAGAGGAGCCAGGTGCAGAGGGG - Intronic
1148083558 17:44980669-44980691 CACAGTGACAAGATCCAGAGGGG - Intergenic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1150283606 17:63943543-63943565 CAGAGACACCATATGCACAGAGG - Intronic
1150455366 17:65302985-65303007 TAGAGAAACTAGAGGCAGAGTGG + Intergenic
1150474224 17:65462151-65462173 CAGAGTAGCCAAATTCATAGAGG - Intergenic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152899131 17:82929945-82929967 ACGAGTGACAAGATGCAGAGAGG - Intronic
1154311966 18:13273864-13273886 CAGAGCAAGAAGAGGCAGAGTGG - Intronic
1155071381 18:22319796-22319818 ATGAGGAACCAGAGGCAGAGAGG + Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1156081702 18:33343482-33343504 TAAAGTGACCAGATGGAGAGTGG + Intronic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157784792 18:50471941-50471963 CAGAGAAACCAAATGCAGGCTGG + Intergenic
1158460638 18:57643413-57643435 CAGAGTAGCCAGATAGAGTGTGG + Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1160596767 18:79980900-79980922 CAGAGTGACCGGACTCAGAGGGG - Intronic
1160684782 19:428657-428679 CAAAGAAAACAGATGCAGACAGG + Intronic
1160860138 19:1234205-1234227 CAGAGTCGCTAGATGCCGAGGGG + Exonic
1166315801 19:41988751-41988773 GAGAGTCACCAGAGGCAGAAGGG - Intronic
1166841792 19:45701910-45701932 CAGAGGTACCAGCTGCAGGGAGG + Exonic
1167699641 19:51034933-51034955 CTGAGGAGCCAGGTGCAGAGTGG - Intronic
1167738109 19:51309975-51309997 CCTAGTAAACAGATGCAAAGTGG + Intergenic
926222711 2:10946694-10946716 CAGAGGAAAGAGATGCAGATGGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927777894 2:25916068-25916090 CAGAGTAACTAGATACAGTGTGG - Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929568634 2:43006210-43006232 CAGAGAGGCCAGAGGCAGAGGGG - Intergenic
930586719 2:53276123-53276145 CAGAGTCACCTGCTTCAGAGAGG - Intergenic
931228777 2:60356546-60356568 CACAGAAACCTGAGGCAGAGAGG - Intergenic
933372732 2:81437397-81437419 CAGAGTAACCATGTGCAGATGGG + Intergenic
933930460 2:87145840-87145862 CAGAGGAACAAGTTGAAGAGTGG + Intergenic
933994481 2:87657835-87657857 AAGAGTGACCAGGTGGAGAGAGG + Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
934818221 2:97348653-97348675 CAGAGTAACAAGAGACAGAGAGG - Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935187127 2:100744603-100744625 CAGAGCAGCCAGTTTCAGAGGGG - Intergenic
936299377 2:111293078-111293100 AAGAGTGACCAGGTGGAGAGAGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937573298 2:123390414-123390436 CCGAGTAATGAGATGCAGACCGG + Intergenic
938194073 2:129310594-129310616 AAGAGCAAACAGATTCAGAGTGG + Intergenic
940394800 2:153175770-153175792 TAGAGGAACCAGTTACAGAGAGG + Intergenic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
941231002 2:162912673-162912695 CAGAGAAACCAGACACGGAGTGG + Intergenic
941840371 2:170076472-170076494 CAGAGCTACTGGATGCAGAGAGG - Intronic
941989062 2:171537018-171537040 CAGAGGAAGCTGAGGCAGAGAGG - Intronic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
944345743 2:198663279-198663301 GAAAGTAACCAGATACACAGTGG - Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169846726 20:10001866-10001888 AAGAGTAACCAAAAACAGAGAGG + Intronic
1170947347 20:20903153-20903175 CACAGTGACCATATGAAGAGGGG - Intergenic
1172222906 20:33285998-33286020 CAGAGGGACCTGAGGCAGAGGGG - Intronic
1172263402 20:33589260-33589282 GAGAGCAGCCAGTTGCAGAGGGG + Intronic
1172729952 20:37078705-37078727 CAGAGTAATCAAATTCATAGAGG + Intronic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173356997 20:42302817-42302839 CAGAGTAAACAAATGCAAATGGG + Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175354136 20:58349222-58349244 CAGAGCAACCAAATGCAGTCAGG + Intronic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1178506847 21:33169597-33169619 CCGAGTAACCACGTGGAGAGTGG + Intronic
1178849888 21:36204387-36204409 CAGCGTCACCATATGAAGAGGGG + Intronic
1179108463 21:38424599-38424621 CAGAGTAGACAGATGCTGTGGGG + Intronic
1179188314 21:39102374-39102396 CACAACAACCAAATGCAGAGAGG + Intergenic
1181654111 22:24281013-24281035 CAGAGGAACAGGAAGCAGAGAGG + Intronic
1182836117 22:33342724-33342746 CAAACTAGACAGATGCAGAGCGG - Intronic
1184405189 22:44296894-44296916 CAGAGTCACCAGGCTCAGAGGGG + Intronic
1184719151 22:46299439-46299461 CAGGGTATGCAGATGCAGAGGGG - Intronic
1185419959 22:50729652-50729674 CAGAGCAGCCACATGCAGATGGG - Intergenic
949346857 3:3084782-3084804 GTGAGAAAACAGATGCAGAGAGG - Intronic
949437031 3:4040786-4040808 CAGAGTAACTAGAACCAGAGAGG + Intronic
950113762 3:10437394-10437416 CTGAGTAAACAGATTCTGAGAGG + Intronic
950307346 3:11926336-11926358 CAGAGTACTCAGATTCATAGAGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
954847470 3:53572344-53572366 CAAACAAACCAGAGGCAGAGAGG - Intronic
955041832 3:55324794-55324816 CAGAATAACCATATGAAGATAGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956780557 3:72599890-72599912 CCGAGTTCCCAGAAGCAGAGTGG + Intergenic
957678787 3:83404565-83404587 CGGAACAACCAGTTGCAGAGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
957923099 3:86772345-86772367 CAGAACAACTAGCTGCAGAGAGG + Intergenic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959340403 3:105122327-105122349 CAGAGGGACCTGATGCAAAGAGG + Intergenic
959484310 3:106909175-106909197 CAGAGCTACCAGCTGCAGAGAGG + Intergenic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960713551 3:120554960-120554982 CAATTTAACCAGATGCAGAATGG + Intergenic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
962932845 3:140053496-140053518 CAAAGGCACCAGATGCAGCGTGG + Intronic
963293927 3:143524104-143524126 CAGAGAAACCAAGTGAAGAGAGG + Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968584941 4:1411944-1411966 CAGAGTAACCACCAGCAGAGAGG - Intergenic
968584955 4:1412004-1412026 CGGAGTAACCACCAGCAGAGAGG - Intergenic
968584968 4:1412064-1412086 CGGAGTAACCACCAGCAGAGAGG - Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
970275092 4:14390865-14390887 CAGTGAAATCAGCTGCAGAGTGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971563670 4:28113435-28113457 CAGATTAGCTAGATACAGAGTGG - Intergenic
971771366 4:30901285-30901307 CAGAAAAACCAGATAGAGAGAGG + Intronic
971852224 4:31997195-31997217 CAGATTAGCTAGATACAGAGTGG - Intergenic
972744302 4:41918318-41918340 CAGAGTAGGCACATGAAGAGAGG + Intergenic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
973336912 4:48965919-48965941 CAGGGCAACTAGAAGCAGAGGGG - Intergenic
973707283 4:53592969-53592991 CAGAGTTCCCAGGTGCAAAGAGG - Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
975749758 4:77510652-77510674 TAGAGGAACCAGATGCAGCCGGG + Intergenic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977932467 4:102763498-102763520 AAGAGTAATCAGATGTGGAGTGG + Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980243227 4:130203234-130203256 CAGTGCAACCAGCTGCAGAGAGG + Intergenic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982151412 4:152462122-152462144 CAGACTACCCAGGTGCAGAGGGG - Intronic
983685833 4:170407680-170407702 CAGAGTAACAATCTGCAGATTGG - Intergenic
985403765 4:189616399-189616421 CAGAGTAGCTAGATACAGTGTGG + Intergenic
986191350 5:5498880-5498902 CAGAATAACAAAATGCAGTGCGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986645180 5:9910324-9910346 TAGAGTAGACAGAGGCAGAGAGG + Intergenic
986711749 5:10492917-10492939 TGGAGAAGCCAGATGCAGAGTGG + Intergenic
987159898 5:15131841-15131863 CAGAGTAAGAACATGCAGACAGG - Intergenic
987318130 5:16743201-16743223 AAGACTAACCAAATGCACAGAGG + Intronic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
991435050 5:66589416-66589438 CCCATTAACCAGATCCAGAGCGG - Intergenic
992052969 5:72957424-72957446 CAGACTAGACAAATGCAGAGAGG - Intronic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
993203670 5:84849556-84849578 CCGCGTGACCAGTTGCAGAGAGG + Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
1004372844 6:15067356-15067378 CAGAGCCACCAAAGGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1005807630 6:29489488-29489510 CTGACGAACCAGATTCAGAGAGG - Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009898380 6:69780961-69780983 AAGAGAAACCAGGTGGAGAGAGG + Intronic
1010301662 6:74267512-74267534 CAGAGAAACAAGATACAGTGAGG + Intergenic
1011713368 6:90078080-90078102 CAGATTGACCAGATGCTGACAGG - Intronic
1012141987 6:95636276-95636298 CAGGTCAACCAGCTGCAGAGAGG - Intergenic
1012988049 6:105896160-105896182 CAGAGTGTCCAGCTGGAGAGAGG + Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018681089 6:166265973-166265995 CAGAGGATTCACATGCAGAGTGG - Intergenic
1019791324 7:3015716-3015738 CAGAGTTACCTGATGCAGCCAGG - Intronic
1021091182 7:16484875-16484897 TAGAGTAACCTGACGCACAGAGG + Intronic
1022381697 7:29866516-29866538 CAGAGTAACCCTATGCTGTGTGG - Intronic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1023477876 7:40600480-40600502 GAGATTAAGCAGATGCACAGAGG - Intronic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1024466008 7:49711865-49711887 CAGAGTAGCTAGATACAGTGTGG - Intergenic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1027661951 7:80997919-80997941 GTGAGGAACCAGATACAGAGAGG + Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029378202 7:100195071-100195093 CCGAATAACCACATGCAGAGGGG + Intronic
1029777601 7:102694720-102694742 CAAAGAAACCAGATTCATAGTGG + Intergenic
1030215630 7:107042112-107042134 CAGAATAGCTAGATACAGAGTGG + Intergenic
1030318227 7:108137989-108138011 TGGAGTAACTAGATGCAGAGGGG + Intergenic
1030609207 7:111670344-111670366 CAGAGTACCCACATGCTGAATGG + Intergenic
1030728543 7:112956353-112956375 GAGATTAACCAGATTCAAAGAGG - Intergenic
1031243316 7:119273006-119273028 CAAATTGACCAGCTGCAGAGTGG - Intergenic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031378891 7:121060544-121060566 CAGAATAGCTAGATACAGAGTGG - Intronic
1032275565 7:130452341-130452363 GAAGGTAACCAGATGAAGAGTGG - Intergenic
1037085556 8:14844906-14844928 CAGAGTTTTCAGATGCAGGGAGG + Intronic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041779668 8:61563874-61563896 CAGGGTTCCCAGATGCAGAGTGG - Intronic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042396090 8:68293040-68293062 CAGTAGAACCAGATGCAAAGAGG + Intergenic
1043201680 8:77377505-77377527 TAGAGTAATCAGATTCAGACAGG - Intergenic
1043299266 8:78706065-78706087 CAAACCAACCAGAGGCAGAGAGG - Intronic
1044405003 8:91817091-91817113 CAGAGTAGCTAGATACAGAGTGG - Intergenic
1046861947 8:119102772-119102794 CAGCCTGACCAGATGCAGACAGG + Intronic
1048385007 8:133904162-133904184 CAGAGTAACCAGGTTGGGAGGGG + Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1056343517 9:85664650-85664672 CAGAGTAACCATAGGAAGAGGGG - Intronic
1056738759 9:89234647-89234669 CAGATTAACCCTATGCAGATCGG - Intergenic
1057229487 9:93311093-93311115 CAGAGAGACCAGAAGCAGAATGG - Intronic
1057230640 9:93319497-93319519 AAGTGTAATCAGGTGCAGAGTGG - Intronic
1057442522 9:95092322-95092344 CAGAGCAGCCAGATGCTGGGTGG - Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1060212604 9:121719742-121719764 TGGGGAAACCAGATGCAGAGAGG + Intronic
1061219411 9:129241696-129241718 CAGCGTCACCAAAGGCAGAGGGG - Intergenic
1061654488 9:132078641-132078663 CTTAGTAACCAGATGGAAAGAGG - Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062350488 9:136136342-136136364 CATGGTAACCAAATGCAGAATGG - Intergenic
1188413451 X:29902494-29902516 CACAGTAATCAAATGAAGAGAGG - Intronic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1188981160 X:36728445-36728467 TAGAGGAACCAGAAGCAGTGTGG - Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1191836487 X:65469215-65469237 CAGAGCAACAAGCTGCAAAGGGG + Intronic
1191841093 X:65514025-65514047 CAGAATGCCCAGATGAAGAGGGG + Intronic
1191846799 X:65552788-65552810 GGGAGAAACCAGGTGCAGAGAGG - Intergenic
1192192615 X:69001074-69001096 CAGAGGAAACAGATGCAAAGTGG + Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1194379386 X:93175347-93175369 CAGAAAATCCAGCTGCAGAGAGG + Intergenic
1195366699 X:104133557-104133579 AATAGTAACCAGAAGCAGGGAGG - Intronic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1198020576 X:132653564-132653586 CAGAGAAAACAGATTCAGAGAGG + Intronic
1199579415 X:149346409-149346431 CATAGTAATGAGATGCTGAGGGG - Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1200285965 X:154822554-154822576 CAGAGAAACCAGATTAAGCGAGG - Intergenic
1201482266 Y:14452317-14452339 CAGAGAAACCAAAAGCTGAGGGG + Intergenic
1201761878 Y:17549275-17549297 CAAAGTAAACAGAAACAGAGTGG - Intergenic
1201839674 Y:18356715-18356737 CAAAGTAAACAGAAACAGAGTGG + Intergenic