ID: 955921941

View in Genome Browser
Species Human (GRCh38)
Location 3:63966323-63966345
Sequence GTGAACAATACTAAGACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955921937_955921941 4 Left 955921937 3:63966296-63966318 CCCTGCAGGGAGGGCAGGTGAAG 0: 1
1: 0
2: 7
3: 44
4: 407
Right 955921941 3:63966323-63966345 GTGAACAATACTAAGACCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 122
955921936_955921941 5 Left 955921936 3:63966295-63966317 CCCCTGCAGGGAGGGCAGGTGAA 0: 1
1: 0
2: 0
3: 37
4: 314
Right 955921941 3:63966323-63966345 GTGAACAATACTAAGACCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 122
955921932_955921941 14 Left 955921932 3:63966286-63966308 CCTTGGCTACCCCTGCAGGGAGG 0: 1
1: 0
2: 3
3: 51
4: 297
Right 955921941 3:63966323-63966345 GTGAACAATACTAAGACCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 122
955921938_955921941 3 Left 955921938 3:63966297-63966319 CCTGCAGGGAGGGCAGGTGAAGT 0: 1
1: 0
2: 5
3: 31
4: 323
Right 955921941 3:63966323-63966345 GTGAACAATACTAAGACCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955921941 Original CRISPR GTGAACAATACTAAGACCTG TGG Intronic
900134274 1:1108100-1108122 GTGAACAGTGCTGAGACATGGGG - Intronic
901369758 1:8787066-8787088 GTGGACCATGCTAAGACCTCTGG - Intronic
902193138 1:14777802-14777824 GTGAGCAATTCTCAGAACTGAGG + Intronic
916800428 1:168210689-168210711 GTAAACAATTCTATTACCTGGGG - Intergenic
917760379 1:178150612-178150634 TTGAACACTTCTAAAACCTGTGG + Intronic
917940708 1:179918266-179918288 GTGAACAATTCTCAGAACTTGGG - Exonic
919064769 1:192680099-192680121 GTAAACAAAACTAAGACATTTGG - Intergenic
919159853 1:193814838-193814860 GAGAACATCACCAAGACCTGTGG + Intergenic
922815882 1:228448939-228448961 GTGAGCAATTCTTGGACCTGAGG - Intergenic
1069492762 10:68875381-68875403 GTGAACACTCCCAAGAACTGTGG - Intronic
1070931168 10:80261493-80261515 GTGAGCAGTCCTAGGACCTGAGG - Intergenic
1071186773 10:83055444-83055466 GTGGACAATTCTGAAACCTGTGG + Intergenic
1072409631 10:95188351-95188373 GTAAAGAATGCTATGACCTGTGG + Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1083339290 11:61948497-61948519 TTGAACAATCCCAACACCTGGGG + Intergenic
1083880258 11:65544917-65544939 GTGAAGAAGAACAAGACCTGGGG - Intronic
1090455027 11:126841813-126841835 GTGAGCATGACTAAGACCTTCGG - Intronic
1092028656 12:5264697-5264719 GAGAGCAAATCTAAGACCTGAGG - Intergenic
1094031281 12:26013985-26014007 GTGGACAAAACTCAGACCTGTGG + Intronic
1096212265 12:49775903-49775925 GATATCAAAACTAAGACCTGTGG - Intergenic
1098465128 12:70778269-70778291 GTGAAAAATACTGTGGCCTGAGG + Intronic
1099150530 12:79106279-79106301 GTGAACTATACTTGGACCTTAGG - Intronic
1099207321 12:79743590-79743612 GTGAAGAATAGTAAGACATGAGG - Intergenic
1099601921 12:84750579-84750601 GGAATCAATACTAAGAACTGAGG - Intergenic
1101467458 12:104962414-104962436 GGGAACAGTAATAATACCTGGGG + Intergenic
1105350040 13:19606714-19606736 GAGAATTATACTCAGACCTGAGG + Intergenic
1106296681 13:28420500-28420522 GTGATCAATATTAAAACATGAGG + Intronic
1110701338 13:78552305-78552327 GTGAAGAATAGTAAGAGATGAGG + Intergenic
1115464156 14:33696139-33696161 TAGAAAAATACTAAAACCTGGGG - Intronic
1119081762 14:71701197-71701219 ATAAACAATAGGAAGACCTGGGG - Intronic
1120090866 14:80332134-80332156 GTGAACAACACAGATACCTGGGG - Intronic
1120862701 14:89269130-89269152 GTCATCAACACCAAGACCTGTGG + Intronic
1121280445 14:92693601-92693623 GAGAACAAGACTCAAACCTGGGG + Intergenic
1124791707 15:32733204-32733226 GTGGACAATACAAAGATTTGGGG - Exonic
1128652058 15:69424030-69424052 ATAAATAATACGAAGACCTGTGG + Intronic
1132245766 15:100295057-100295079 ATGAAAAATAGTAAGACATGTGG + Intronic
1135055071 16:19225132-19225154 GTGAACAATAATAGTACGTGTGG + Intronic
1135376971 16:21955717-21955739 GTCAAAAAAACTAAGACCTTTGG + Intronic
1138293780 16:55869728-55869750 GGGAACCACACCAAGACCTGAGG + Exonic
1141083434 16:81074117-81074139 GAGAAGAATACCAAGAACTGAGG - Intronic
1141406319 16:83796898-83796920 GTCAACAGTCCCAAGACCTGGGG + Intronic
1146778145 17:35640600-35640622 GTGAGCATTATTAACACCTGGGG + Intronic
1146933409 17:36793971-36793993 TTAAACAGAACTAAGACCTGTGG + Intergenic
1156369229 18:36457756-36457778 GTGAACTCTACTAAGCTCTGGGG - Intronic
1156408372 18:36804618-36804640 GTCTCCAATACTAAGACCTTGGG - Intronic
1156818588 18:41342623-41342645 GTGAAAGATATTAAGAGCTGTGG + Intergenic
1159572906 18:70140290-70140312 ATTAAAAATACTTAGACCTGGGG + Intronic
1159673714 18:71254646-71254668 TTGAACAATTCTATGGCCTGTGG + Intergenic
1168163300 19:54527602-54527624 GTGAAAACCACAAAGACCTGTGG + Intergenic
925712086 2:6751105-6751127 GTGAGCAATACTATTTCCTGGGG + Intergenic
926073444 2:9920603-9920625 GTGATCACTATTAACACCTGAGG - Intronic
929060340 2:37917678-37917700 GTGAGCAATTCTCAGAACTGAGG + Intergenic
933816200 2:86070525-86070547 CTGAAGAAGACAAAGACCTGTGG - Intronic
939211673 2:139183535-139183557 TTGACTAATACTAAGACCTATGG + Intergenic
944622574 2:201531797-201531819 GGGAACAATGCTAACACATGAGG + Intronic
946817709 2:223595950-223595972 GTGACCCATACTAAAACCTTGGG + Intergenic
947014034 2:225597995-225598017 GTGAATCATTCTACGACCTGAGG + Intronic
947037224 2:225873279-225873301 GAAAACAATACTAATTCCTGAGG - Intergenic
948335478 2:237203809-237203831 GAGAACAATTCTAACACCTTGGG - Intergenic
1175309129 20:57999213-57999235 GAGAATAATAATAATACCTGGGG + Intergenic
1183729730 22:39611237-39611259 GTTAACAATACTAATTTCTGGGG - Intronic
952179887 3:30906528-30906550 GTGAACAATTCCCAGAACTGAGG + Intergenic
955680083 3:61491120-61491142 GTGAATAATACTAAGGAATGAGG + Intergenic
955921941 3:63966323-63966345 GTGAACAATACTAAGACCTGTGG + Intronic
955921969 3:63966601-63966623 GTCAACAATACTAAGACCCAGGG - Intronic
958867594 3:99519132-99519154 GTGAACAAGAATGAGCCCTGGGG + Intergenic
960284904 3:115817128-115817150 GTGATCAATACAAAGATCTAGGG - Intronic
961006119 3:123406453-123406475 CTGAACAATAATAAAACCTACGG + Intronic
963921130 3:150906892-150906914 ATGAACATTTCTGAGACCTGTGG - Intronic
964114596 3:153122470-153122492 GTCAACAAAAATAAGCCCTGAGG - Intergenic
965743259 3:171899128-171899150 GTGAACTGCACTAAGACATGGGG + Intronic
972288752 4:37671611-37671633 GTGAGCAATTCTCAGAACTGAGG - Intronic
975331774 4:73124062-73124084 AAGAACAAAACTAAGAACTGTGG + Intronic
976772855 4:88673241-88673263 GTGCACAATACTCATAACTGGGG - Intronic
977179141 4:93852771-93852793 GTGAACAAAACAATGACCTTTGG + Intergenic
980013433 4:127622472-127622494 GTGAACTATTCTATGGCCTGTGG - Intergenic
980755757 4:137158002-137158024 GTGAACTATATTAAGTCTTGAGG + Intergenic
982503186 4:156185013-156185035 GTGAAAATTGTTAAGACCTGAGG + Intergenic
982779469 4:159475855-159475877 GTGAACAGTTCAAGGACCTGAGG - Intergenic
983301591 4:165933312-165933334 GGGAACAACACTCAGATCTGAGG - Intronic
988088675 5:26506394-26506416 TTGTACATTACTAAGACCTCTGG - Intergenic
989749839 5:44880064-44880086 GTGAAAAATAATAATATCTGGGG - Intergenic
993515100 5:88822440-88822462 GTGAATAATACTAAGATTTATGG - Intronic
993536716 5:89095638-89095660 GTGAACACTGCTAAGAAGTGTGG + Intergenic
996930974 5:128886742-128886764 GTGAACTATACGGATACCTGAGG + Intronic
998438433 5:142134739-142134761 ATGAACAATACCAACACATGTGG - Intronic
1001395116 5:171413269-171413291 ATGAACAATTCTAAGTGCTGAGG + Intergenic
1002013096 5:176300287-176300309 ATGAACAAAACTAAGATATGGGG + Intronic
1004827260 6:19436475-19436497 GTGAACAATGATAAGTCCTATGG + Intergenic
1010139157 6:72593396-72593418 GTGAAAAATACTATTACCAGTGG - Intergenic
1011014522 6:82740226-82740248 GAGAACAAAACTAGGACCAGTGG - Intergenic
1016889497 6:148992031-148992053 GTGAAGAATACCATGACCTGTGG + Intronic
1019063568 6:169275979-169276001 GTGAACAGTACCATGACATGAGG - Intergenic
1022280430 7:28903292-28903314 ATGAATAATACTAAGACCCAGGG + Intergenic
1023086175 7:36571802-36571824 GTTAATAATAATAAGGCCTGTGG - Intronic
1024522378 7:50316728-50316750 GTGATCAATGCTAAGTCCTCTGG - Intronic
1026018722 7:66692588-66692610 GTCAACAATCCTGAGATCTGGGG + Intronic
1027515425 7:79136677-79136699 GTGAACAATTCTAAGTGCTCTGG + Intronic
1028720431 7:94024268-94024290 GTGGACAATGATAAGGCCTGAGG + Intergenic
1029949227 7:104565204-104565226 CTGAAAAATATTAAGTCCTGTGG + Intronic
1031050200 7:116937147-116937169 GTGAACAAAACAAAGACCCCTGG - Intergenic
1031585880 7:123532534-123532556 GAGAACAATACACAGACCTTTGG + Exonic
1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG + Intergenic
1033804736 7:144940920-144940942 GTGAACAGACCTAGGACCTGGGG - Intergenic
1033810228 7:145003282-145003304 GTTAACAAAATAAAGACCTGGGG + Intergenic
1037067843 8:14604644-14604666 GGAAACAATACTATGAGCTGTGG - Intronic
1041996632 8:64069298-64069320 GTGAACAATAATCAGAACAGTGG - Intergenic
1042470918 8:69186960-69186982 GTGAACAAAAGTTAGATCTGGGG + Intergenic
1044595853 8:93957596-93957618 GTGAACAATTCTATTACCAGGGG + Intergenic
1045508648 8:102796179-102796201 GTGTACAAGACTAATATCTGGGG - Intergenic
1046050772 8:109019686-109019708 ATGAACGATAAGAAGACCTGGGG + Intergenic
1046350800 8:113008292-113008314 GTGAACAATAACAAAAGCTGAGG + Intronic
1046372082 8:113323250-113323272 GTGAATTATACTAAGCCTTGAGG - Intronic
1046883882 8:119341066-119341088 GTAAACACTAGTAAGACCAGAGG + Intergenic
1047720072 8:127630926-127630948 GTGGACAACACAATGACCTGGGG + Intergenic
1049296914 8:141845671-141845693 CTGAAGAAAACTAAGACCAGAGG + Intergenic
1051213287 9:14768534-14768556 GTGCACAGTACTAGGAGCTGGGG - Intronic
1052984706 9:34478298-34478320 GTGTACAATAGGAAGACCAGAGG + Intronic
1057118368 9:92546899-92546921 GTGAAGAATATAGAGACCTGTGG - Intronic
1059536353 9:115084625-115084647 GTGATCCATCTTAAGACCTGTGG + Intronic
1060800153 9:126538981-126539003 GTGAAGAATAGTAAGAGCTGAGG + Intergenic
1186154024 X:6707235-6707257 GTGCACCACACTCAGACCTGTGG + Intergenic
1188810113 X:34643175-34643197 CTGAACAAGACTAAGATATGGGG + Intronic
1188871599 X:35380373-35380395 GTGACCAAAACTTAGACATGTGG - Intergenic
1190188000 X:48252676-48252698 GTTAACAATATTAAGAGGTGGGG + Intronic
1191636858 X:63387877-63387899 GTGAACAATTCCCAGAACTGAGG - Intergenic
1195428082 X:104758044-104758066 GTAAAGAATATGAAGACCTGGGG + Intronic
1198063934 X:133077004-133077026 GTAACCAATACTAAGTACTGGGG + Intronic