ID: 955923232

View in Genome Browser
Species Human (GRCh38)
Location 3:63980413-63980435
Sequence CATAGTACACACATAGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955923232_955923234 7 Left 955923232 3:63980413-63980435 CCTAACTCTATGTGTGTACTATG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 955923234 3:63980443-63980465 TCACAACAACCCTATGGAATAGG 0: 1
1: 6
2: 81
3: 452
4: 1649
955923232_955923233 1 Left 955923232 3:63980413-63980435 CCTAACTCTATGTGTGTACTATG 0: 1
1: 0
2: 1
3: 13
4: 137
Right 955923233 3:63980437-63980459 CACTTATCACAACAACCCTATGG 0: 1
1: 0
2: 7
3: 27
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955923232 Original CRISPR CATAGTACACACATAGAGTT AGG (reversed) Intronic
903930609 1:26859912-26859934 CAAAGCACTAACATAGAGTTAGG - Intergenic
906287961 1:44600318-44600340 CAGAGATCACACATAGAGTGTGG + Intronic
908321302 1:62981624-62981646 TATACTACAAAAATAGAGTTTGG + Intergenic
918016468 1:180638255-180638277 CATTGTACACAGATACAGATGGG + Intronic
918127015 1:181593161-181593183 AATAGTACACTCATATAGTGAGG - Intronic
918672259 1:187233268-187233290 CATAGTAGACACATATTTTTGGG + Intergenic
918782149 1:188714344-188714366 CATAATACAAACAAAGAGATAGG + Intergenic
919298701 1:195734209-195734231 CATAGAACAGAGATAAAGTTTGG + Intergenic
921718528 1:218444768-218444790 CATAGTAAACTCATAGAGAGAGG + Intergenic
922097053 1:222451445-222451467 CATAGCACACATAGGGAGTTTGG + Intergenic
923278213 1:232416721-232416743 CAAAGCACACACATAGTGGTTGG + Intronic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924052229 1:240091194-240091216 TATGGTAAACACATAGAATTTGG + Intronic
1064130102 10:12701906-12701928 CATATTCCACACATAGATATAGG + Intronic
1065519369 10:26556459-26556481 CATAGCACACATATAGTGTAAGG + Intronic
1065529793 10:26657075-26657097 CCTAGGAAACACATGGAGTTTGG + Intergenic
1065889427 10:30108511-30108533 CACAGTACACACTCAGAGTGAGG + Intronic
1066168330 10:32813634-32813656 CATAGTACATACCTACAGGTTGG + Intronic
1072645934 10:97253881-97253903 CATAGTATACATATAGGGTTTGG + Intronic
1075441651 10:122484658-122484680 CATAGAAAACACATTGAGGTAGG + Intronic
1075529306 10:123214280-123214302 CATCGGACACACACAGAGTGAGG - Intergenic
1076264664 10:129100244-129100266 CACAGGACACTCATACAGTTGGG + Intergenic
1077813579 11:5663358-5663380 TATAATACACACATATATTTAGG - Intergenic
1081134413 11:39421107-39421129 AATAGGACACACATATATTTGGG + Intergenic
1083106726 11:60365405-60365427 CATAGCACTGACATCGAGTTGGG + Intronic
1085706695 11:78792821-78792843 CAGAGTTCACACACAGAGATTGG - Intronic
1088843187 11:113643799-113643821 CACAGCACACACATACAGTGGGG - Intergenic
1088967661 11:114740026-114740048 CATAGTATATATATAGTGTTTGG - Intergenic
1089910421 11:122093851-122093873 CATAGTAGACACCTAGAATATGG - Intergenic
1090876604 11:130794488-130794510 CCTAGGGCACACATAGAGCTGGG + Intergenic
1093619580 12:21273134-21273156 CATTGTACACACAGTGAATTTGG + Intronic
1095497021 12:42795751-42795773 AATAGTACAATAATAGAGTTAGG + Intergenic
1100112307 12:91260424-91260446 AAGAGTACAAACATACAGTTAGG + Intergenic
1106769929 13:32952171-32952193 CATGGTACACACAGAGCTTTGGG - Intergenic
1109052500 13:57502227-57502249 CATTGTACAGCCATAGTGTTTGG - Intergenic
1109473942 13:62852866-62852888 CATAGTATATATATAGGGTTTGG - Intergenic
1109758328 13:66792319-66792341 CATTGTACTCCTATAGAGTTAGG + Intronic
1110649838 13:77930947-77930969 GATAATACACATTTAGAGTTTGG - Intergenic
1112310407 13:98313161-98313183 CATAATACACACATACACTCTGG + Intronic
1117786793 14:59294098-59294120 CATAGTAAAGTCATAGAGTAAGG + Intronic
1117901809 14:60542226-60542248 CAAAGTCCACACACAGAGTTGGG + Intergenic
1118671708 14:68135505-68135527 AATAGTATACACATAGACATAGG + Intronic
1202893993 14_KI270722v1_random:185431-185453 CATAATTCACAGAAAGAGTTGGG - Intergenic
1123885866 15:24727849-24727871 CCTAGTAGAAACATACAGTTCGG - Intergenic
1138298305 16:55905753-55905775 CAAAGCACACAGATAAAGTTGGG + Intronic
1149426423 17:56558838-56558860 CAGAGTGCCCACAAAGAGTTGGG - Intergenic
1150054551 17:62001703-62001725 TATAGTACAGACACAGAGTGGGG - Intronic
1153449459 18:5210688-5210710 AATAGCCAACACATAGAGTTTGG + Intergenic
1155107353 18:22680629-22680651 CATAGTATATATATAGGGTTTGG - Intergenic
1155430934 18:25756744-25756766 CTTAGAACACACACTGAGTTTGG - Intergenic
1156064404 18:33121996-33122018 CCTAGTACACACCTAGTGTATGG - Intronic
1158229961 18:55243377-55243399 AATAATACACACATACAGTGAGG - Intronic
1163099955 19:15089385-15089407 CACAGGAAACACATAGATTTTGG - Intergenic
1168410375 19:56136168-56136190 CATAACACACTCAGAGAGTTGGG - Intronic
926521447 2:13920567-13920589 AATGGTACAAAAATAGAGTTTGG + Intergenic
928464142 2:31504531-31504553 CTTGGTACACAGATAAAGTTGGG + Intergenic
932982981 2:76692607-76692629 TATAGTACACACAAAAATTTGGG - Intergenic
939910869 2:147981222-147981244 CATAGTATATAGAGAGAGTTGGG - Intronic
941128520 2:161617096-161617118 CATAGTACCAACACTGAGTTTGG + Intronic
941311649 2:163940154-163940176 CTTAGGAGACATATAGAGTTAGG - Intergenic
944296825 2:198074714-198074736 CATAGGACACAAAGAGAGGTGGG + Intronic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
946276937 2:218638612-218638634 CACATTGCACACATAGGGTTTGG + Exonic
946702686 2:222428516-222428538 CATAGTTCTCACATTGACTTAGG + Intronic
1170285436 20:14703552-14703574 CATAATACATTAATAGAGTTGGG + Intronic
1170342110 20:15340650-15340672 TATGGAACACACATAGACTTTGG + Intronic
1179082150 21:38181186-38181208 GATAGTACACACATAGGGTCCGG + Intronic
950175511 3:10870876-10870898 CACAGTGCAGACAAAGAGTTAGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951350315 3:21599549-21599571 CATAGTATAAACATGGAGTTTGG + Intronic
953013892 3:39053900-39053922 CAAAGTACAAAATTAGAGTTTGG + Intronic
955923232 3:63980413-63980435 CATAGTACACACATAGAGTTAGG - Intronic
957200070 3:77122596-77122618 CATAGTAAACCCATAGAGAATGG + Intronic
957455501 3:80438339-80438361 CATATTACACTCAGAAAGTTTGG + Intergenic
957730482 3:84126583-84126605 CCATGTACACACATAGAGTTTGG - Intergenic
957887875 3:86313839-86313861 CACAGTCTACACATAGAGTCTGG + Intergenic
959743946 3:109754373-109754395 CATCGTATCCACCTAGAGTTAGG + Intergenic
960407644 3:117281625-117281647 AATAGTACAGACTTAGAATTAGG + Intergenic
962380251 3:134892815-134892837 CAAATTACACACCAAGAGTTAGG - Intronic
962992713 3:140593532-140593554 CATAGAAAGCTCATAGAGTTGGG - Intergenic
963455962 3:145548355-145548377 TCTAGTAGACACATACAGTTAGG + Intergenic
963805327 3:149715726-149715748 CATATACCTCACATAGAGTTGGG + Intronic
964306015 3:155340708-155340730 AATAGTACAGATATAGAGATTGG - Intergenic
965308203 3:167095092-167095114 CACAGTCCACACTTAGAGTAGGG - Intergenic
965941408 3:174187052-174187074 CATAGTACTCACATTGTATTCGG - Intronic
966551644 3:181211646-181211668 CATAGTCCAGATATAGAGTTGGG - Intergenic
967531827 3:190556677-190556699 CCTAGTACACACAAAGTGTAGGG + Intronic
969067615 4:4500428-4500450 CATAGTACATACATTGTATTGGG + Intronic
972721703 4:41706021-41706043 CAGAGTATACACATATATTTAGG + Intergenic
973911192 4:55582538-55582560 CATCATACACAAATACAGTTTGG + Intronic
975385196 4:73749853-73749875 CAAATTACATACATAGATTTTGG - Intergenic
976054757 4:81050552-81050574 AATAGCAAACACATAGAATTAGG + Intronic
977404682 4:96581116-96581138 CAAAGCACTCACATACAGTTAGG - Intergenic
978523028 4:109636159-109636181 CATAGTACAGACATGGTTTTGGG + Intronic
981119110 4:141028090-141028112 CATACTACATACACAGTGTTGGG + Intronic
986568006 5:9134789-9134811 CAAAGTACAGACATACACTTTGG - Intronic
986881859 5:12184017-12184039 CAATGAACACACATAGAGTTGGG + Intergenic
987159382 5:15125344-15125366 AATAGTAGAGACACAGAGTTGGG - Intergenic
987898021 5:23973546-23973568 TTTAGTACAATCATAGAGTTGGG + Intronic
991603745 5:68379661-68379683 CCTAGTAAACACATAGCATTTGG - Intergenic
993465864 5:88246107-88246129 CATAGTAAAGAGATAGAGTGAGG - Intronic
994479735 5:100318822-100318844 CATAGTGCACACAATGAATTAGG + Intergenic
994491815 5:100457045-100457067 CATGTTACTCACATAGTGTTTGG + Intergenic
998684018 5:144503829-144503851 CAGAGTACACACATACATTTAGG + Intergenic
1000743487 5:164999718-164999740 CATAGTACACAGTTACAGATAGG + Intergenic
1002106794 5:176883318-176883340 CATGGTACACACCTGGTGTTTGG - Intronic
1005184582 6:23150757-23150779 CTTACTACACACATAGGCTTAGG + Intergenic
1005286273 6:24330426-24330448 CATTGTACAAACATATTGTTTGG + Intronic
1007070120 6:39030253-39030275 AATAGGACACACATACAGCTTGG - Exonic
1007800253 6:44386356-44386378 CATAGTACACACATATTTATGGG - Intergenic
1008343315 6:50393981-50394003 CATAGAATTTACATAGAGTTGGG - Intergenic
1008776298 6:55042577-55042599 CATAGTACACATATATATTTAGG + Intergenic
1010300992 6:74259201-74259223 CAAAGTACACTTATATAGTTAGG + Intergenic
1011263849 6:85495690-85495712 CACAATACACACACAGATTTAGG - Exonic
1013648664 6:112171148-112171170 CAAAGTACACATATATAGTAAGG - Intronic
1014420471 6:121238096-121238118 CAAAGTATATACACAGAGTTTGG + Intronic
1014661100 6:124172871-124172893 AATAGTTCACATATAGAGTTTGG + Intronic
1014981091 6:127947199-127947221 TTTAGTACACTCATTGAGTTGGG - Intergenic
1016100050 6:140088363-140088385 CATAGTACACATAAATAGTGTGG - Intergenic
1016543960 6:145199480-145199502 CACAGTACAGAATTAGAGTTGGG - Intergenic
1017797679 6:157861720-157861742 CATAGTACACACATAAGGTTTGG - Intronic
1021727161 7:23559411-23559433 TATGGTACAAACATACAGTTAGG - Intergenic
1029412241 7:100421375-100421397 CTTAGAACACACATATAATTTGG + Intronic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1029885686 7:103868319-103868341 CTTAACACAGACATAGAGTTTGG - Intronic
1031915827 7:127562158-127562180 CATAGTAAGCACTTAGTGTTAGG - Intergenic
1037349048 8:17929760-17929782 AATAACATACACATAGAGTTTGG - Intronic
1038854836 8:31319955-31319977 CATAGAACCCCCAGAGAGTTGGG - Intergenic
1040643526 8:49369946-49369968 CATAGTATATATAGAGAGTTCGG + Intergenic
1042947142 8:74166489-74166511 CATAGAAAAAACATAGAATTTGG - Intergenic
1043252572 8:78093595-78093617 CAAACTACACACACAGAATTTGG + Intergenic
1043564138 8:81528964-81528986 TATAGTACATACGTAGTGTTGGG - Intronic
1044768930 8:95608800-95608822 CTTAGTACAGTCATAGACTTAGG - Intergenic
1046476212 8:114747477-114747499 CATAGTAATAACATAGAATTTGG + Intergenic
1051521206 9:17991230-17991252 TATAGTATACAGATAGAGCTGGG - Intergenic
1052671731 9:31566439-31566461 CAAAGTACAAACAGAAAGTTAGG + Intergenic
1053632007 9:39952021-39952043 CATAGGATACACATAGAGCAGGG - Intergenic
1053773757 9:41511510-41511532 CATAGGATACACATAGAGCAGGG + Intergenic
1054211880 9:62298677-62298699 CATAGGATACACATAGAGCAGGG + Intergenic
1054313104 9:63550152-63550174 CATAGGATACACATAGAGCAGGG - Intergenic
1056725338 9:89109386-89109408 CAGAATACATACATAGAGTTGGG + Intronic
1059131267 9:111752274-111752296 CAGAGTTTATACATAGAGTTTGG - Intronic
1060501766 9:124162901-124162923 CATAGTTTACACATAGAATTTGG + Intergenic
1203491034 Un_GL000224v1:104648-104670 CATAATTCACAGAAAGAGTTGGG - Intergenic
1203503658 Un_KI270741v1:46519-46541 CATAATTCACAGAAAGAGTTGGG - Intergenic
1186081062 X:5932285-5932307 CATAGAAGAAACATAGACTTGGG + Intronic
1186134250 X:6502420-6502442 TATAGTAAACACATAGAGTCAGG + Intergenic
1188330639 X:28866864-28866886 CAGACTACACAGATAAAGTTAGG + Intronic
1190388697 X:49910682-49910704 TAGAGTACACACACAGATTTAGG - Intergenic
1196989202 X:121309239-121309261 CAAGGTACAGAGATAGAGTTTGG - Intergenic
1197927444 X:131661911-131661933 CATAGTGCACACCTCGAGTCTGG + Intergenic
1199544698 X:148995579-148995601 CATAGTGCTCACATTGGGTTAGG + Exonic