ID: 955928087

View in Genome Browser
Species Human (GRCh38)
Location 3:64027648-64027670
Sequence CTTGCAACACAGATAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955928087_955928088 -2 Left 955928087 3:64027648-64027670 CCTTTTTTTATCTGTGTTGCAAG No data
Right 955928088 3:64027669-64027691 AGCCCTTTGCTATTAGAACCTGG No data
955928087_955928093 26 Left 955928087 3:64027648-64027670 CCTTTTTTTATCTGTGTTGCAAG No data
Right 955928093 3:64027697-64027719 TTTCGAGATCGCACCAAGCAGGG No data
955928087_955928092 25 Left 955928087 3:64027648-64027670 CCTTTTTTTATCTGTGTTGCAAG No data
Right 955928092 3:64027696-64027718 ATTTCGAGATCGCACCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955928087 Original CRISPR CTTGCAACACAGATAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr