ID: 955931092

View in Genome Browser
Species Human (GRCh38)
Location 3:64057735-64057757
Sequence AGGTGTCATGAATTCCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955931092_955931093 -7 Left 955931092 3:64057735-64057757 CCTTTTAGGAATTCATGACACCT No data
Right 955931093 3:64057751-64057773 GACACCTAGACACACCATAAAGG No data
955931092_955931096 17 Left 955931092 3:64057735-64057757 CCTTTTAGGAATTCATGACACCT No data
Right 955931096 3:64057775-64057797 TGCCCCCAATTTGCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955931092 Original CRISPR AGGTGTCATGAATTCCTAAA AGG (reversed) Intergenic