ID: 955931096

View in Genome Browser
Species Human (GRCh38)
Location 3:64057775-64057797
Sequence TGCCCCCAATTTGCCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955931094_955931096 -3 Left 955931094 3:64057755-64057777 CCTAGACACACCATAAAGGCTGC No data
Right 955931096 3:64057775-64057797 TGCCCCCAATTTGCCCAAGAAGG No data
955931092_955931096 17 Left 955931092 3:64057735-64057757 CCTTTTAGGAATTCATGACACCT No data
Right 955931096 3:64057775-64057797 TGCCCCCAATTTGCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955931096 Original CRISPR TGCCCCCAATTTGCCCAAGA AGG Intergenic