ID: 955932619

View in Genome Browser
Species Human (GRCh38)
Location 3:64072871-64072893
Sequence TGATTTTAGGTATTGATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932619_955932628 27 Left 955932619 3:64072871-64072893 CCACTTATCAATACCTAAAATCA No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932619 Original CRISPR TGATTTTAGGTATTGATAAG TGG (reversed) Intergenic
No off target data available for this crispr