ID: 955932623

View in Genome Browser
Species Human (GRCh38)
Location 3:64072896-64072918
Sequence ATAAAGGAGGAAAAAAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932623_955932628 2 Left 955932623 3:64072896-64072918 CCTCCCTTTTTTTCCTCCTTTAT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932623_955932631 30 Left 955932623 3:64072896-64072918 CCTCCCTTTTTTTCCTCCTTTAT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932623 Original CRISPR ATAAAGGAGGAAAAAAAGGG AGG (reversed) Intergenic
No off target data available for this crispr