ID: 955932624

View in Genome Browser
Species Human (GRCh38)
Location 3:64072899-64072921
Sequence AGAATAAAGGAGGAAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932624_955932628 -1 Left 955932624 3:64072899-64072921 CCCTTTTTTTCCTCCTTTATTCT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932624_955932631 27 Left 955932624 3:64072899-64072921 CCCTTTTTTTCCTCCTTTATTCT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932624_955932632 28 Left 955932624 3:64072899-64072921 CCCTTTTTTTCCTCCTTTATTCT No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932624 Original CRISPR AGAATAAAGGAGGAAAAAAA GGG (reversed) Intergenic