ID: 955932625

View in Genome Browser
Species Human (GRCh38)
Location 3:64072900-64072922
Sequence AAGAATAAAGGAGGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932625_955932631 26 Left 955932625 3:64072900-64072922 CCTTTTTTTCCTCCTTTATTCTT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932625_955932632 27 Left 955932625 3:64072900-64072922 CCTTTTTTTCCTCCTTTATTCTT No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data
955932625_955932628 -2 Left 955932625 3:64072900-64072922 CCTTTTTTTCCTCCTTTATTCTT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932625 Original CRISPR AAGAATAAAGGAGGAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr