ID: 955932626

View in Genome Browser
Species Human (GRCh38)
Location 3:64072909-64072931
Sequence ATTCTGTATAAGAATAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932626_955932631 17 Left 955932626 3:64072909-64072931 CCTCCTTTATTCTTATACAGAAT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932626_955932632 18 Left 955932626 3:64072909-64072931 CCTCCTTTATTCTTATACAGAAT No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932626 Original CRISPR ATTCTGTATAAGAATAAAGG AGG (reversed) Intergenic
No off target data available for this crispr