ID: 955932627

View in Genome Browser
Species Human (GRCh38)
Location 3:64072912-64072934
Sequence TTCATTCTGTATAAGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932627_955932632 15 Left 955932627 3:64072912-64072934 CCTTTATTCTTATACAGAATGAA No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data
955932627_955932631 14 Left 955932627 3:64072912-64072934 CCTTTATTCTTATACAGAATGAA No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932627_955932633 29 Left 955932627 3:64072912-64072934 CCTTTATTCTTATACAGAATGAA No data
Right 955932633 3:64072964-64072986 TATGCTGGGTGATGAATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932627 Original CRISPR TTCATTCTGTATAAGAATAA AGG (reversed) Intergenic
No off target data available for this crispr