ID: 955932628

View in Genome Browser
Species Human (GRCh38)
Location 3:64072921-64072943
Sequence TTATACAGAATGAACTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932624_955932628 -1 Left 955932624 3:64072899-64072921 CCCTTTTTTTCCTCCTTTATTCT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932625_955932628 -2 Left 955932625 3:64072900-64072922 CCTTTTTTTCCTCCTTTATTCTT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932621_955932628 4 Left 955932621 3:64072894-64072916 CCCCTCCCTTTTTTTCCTCCTTT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932620_955932628 14 Left 955932620 3:64072884-64072906 CCTAAAATCACCCCTCCCTTTTT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932623_955932628 2 Left 955932623 3:64072896-64072918 CCTCCCTTTTTTTCCTCCTTTAT No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932622_955932628 3 Left 955932622 3:64072895-64072917 CCCTCCCTTTTTTTCCTCCTTTA No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data
955932619_955932628 27 Left 955932619 3:64072871-64072893 CCACTTATCAATACCTAAAATCA No data
Right 955932628 3:64072921-64072943 TTATACAGAATGAACTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932628 Original CRISPR TTATACAGAATGAACTTTCT AGG Intergenic
No off target data available for this crispr