ID: 955932631

View in Genome Browser
Species Human (GRCh38)
Location 3:64072949-64072971
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932625_955932631 26 Left 955932625 3:64072900-64072922 CCTTTTTTTCCTCCTTTATTCTT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932626_955932631 17 Left 955932626 3:64072909-64072931 CCTCCTTTATTCTTATACAGAAT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932623_955932631 30 Left 955932623 3:64072896-64072918 CCTCCCTTTTTTTCCTCCTTTAT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932624_955932631 27 Left 955932624 3:64072899-64072921 CCCTTTTTTTCCTCCTTTATTCT No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data
955932627_955932631 14 Left 955932627 3:64072912-64072934 CCTTTATTCTTATACAGAATGAA No data
Right 955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type